FC928860

Overview
NameFC928860
Unique NameFC928860
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length736
Libraries
Library NameType
PhII-IIIV1cdna_library
Alignments
Feature NameTypeLocationAnalysis
FC928860_ssr160 microsatellite FC928860_ssr160:160..171.
FC928860_ssr234 microsatellite FC928860_ssr234:234..253.
Ccv1_Contig9295 contig Ccv1_Contig9295:11..746. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionKN0AAH1CB03RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1CB03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC928860 ID=FC928860|Name=FC928860|organism=Citrus clementina|type=EST|length=736bp
GGCACGAGGCCCAGGCCGAGCCAAGCACCAATCTTTTTGTCTCCGGTACT
ATTAAAAATCTTTCCTTTTCATTTCGTTTTTGCCTTTTTTTTTAATCAGT
AATTTGTTTATCTTTCTAAATTCATCTTTTTGTTTTGGTCATTTTGTTTG
GACTGTATGTTGTTTGTTTGTAGTTCTCATGGAAACTGATTTTCCTGAGT
GCGATTGTTATTTCAAGATTAGGTGTCAGAACTTTTATTTATTTATTTAT
TTATTTGGAAAAATTTGGAATCAATTCAACTGGTTGCTTGGGAATTGATG
TTGGCTCTATTTAGTTTATGTGATTAGGGTATGTTTGGAATTGAGGTGAT
TTTGACTTTTAATTGCTAGCTGTCACGAATAAGTAGGTCGATCCATTGGC
ATTACTAATTAACAATTGAAATTGGTGTTGAACTACTAGTAAATTATTTA
TGATCAAATAAATGTCCATGTATACGCCTATTCATCCAAACAATAAAAGT
ATTTCTATAATATGGAGTTTTATGGCAACTTAGTTTGATTTTCTTTCTTT
GATTTTTAGTACAATGTAGTCATTTTGGTTGTGTTTTCCATGATTTCTGA
ATTTAGTGGCCAATGTCGGTGTTTATTGTTCTGCTTTGTTTAGATATTTA
GGCATGAGGTATCTACATAGCAAATTAGTTGTCGATTTTACTGTTGTAAA
CTCTATAAGCTGGTTTCATATTTTTATCTTTTTTCT
back to top