FC928888

Overview
NameFC928888
Unique NameFC928888
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length588
Libraries
Library NameType
PhII-IIIV1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig6230 contig Ccv1_Contig6230:682..1269. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionKN0AAH1CD08RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1CD08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC928888 ID=FC928888|Name=FC928888|organism=Citrus clementina|type=EST|length=588bp
GAAATCTGGAGAACGGGAGACATGGGCTTTTAATCTCGATGGTGCTGTTC
AGATGTTCAATTCTTACCGGGAAATGTCATATTGGCCTCTTTTGGAGCAC
CCACCGCAAGGAATGGAGATAGCTATTGTACGTGCAGAAAAGAGTGACCG
ATGGGATCCAGATGTGATTCAGCGGCTTGAAGGCCTTGCCAATAGACAAG
GATATGGATCCGAGGGTAAAGTTTCCGTACATGTTCTTCCCAATGCAGGC
CATTGGGTTCATGTGGACAATCCAAAAGGACTTCTTGAGATTGTGGCTCC
CAGGATTGCATCTGTTTAACTATATTGCAATTTGTTTCGTAGAGCTGTCA
TTTGTTTCAAAAATAATTAAATATCTTCATTATTATTTCTTCATTCTCGC
CCAGCCTGTGTTGGAACAAGGCACTGATTTTGCTTAAAAATTAAAATAAG
TGTAAATCAATCAGAGGTGAGAGTGATGAGTCATCTTTACGAAGCTTAAA
TTGTTTGTTCGAAATCCAGACTTGGTTAATTTAATAATATCGGTGGTTTC
GTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top