FC928908

Overview
NameFC928908
Unique NameFC928908
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length810
Libraries
Library NameType
PhII-IIIV1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig287 contig Ccv1_Contig287:359..1168. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionKN0AAH1CE06RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1CE06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC928908 ID=FC928908|Name=FC928908|organism=Citrus clementina|type=EST|length=810bp
GGCACGAGGTGTGATGTTTGATAGGTATCTCATGGAAGCTAATGATCTTC
TGAAACAAGCAAGAGAGTGTATGAGGAGTGGTTGGGATGGAGAGCGTGCA
GAGATGATATTGCATAAGTCTGCCAGGTTACTCACCCAAGCCATAGCCGT
GAAGCCTATGAGTTTGTTAGCTGTGGGCCAATTGGGCAACACATATCTTG
TTCATGGAGAACTAAAGCTACATTTTAGTCGCAAGTTGAGAAGACTCCTT
TTGGAAGGCGATGTCATATCTGTTGAGAAACAGAAAAGAATACTCAAGGG
GCCAGATTATCAGTTTGTGAATAAAGATAAAATTGCATCTCTTCTTGTTG
ATGCTTGTGAACAATGTGAAGAACTCCTTGTGAATGCTGGTAGAAAATAT
AGGTCGGCTCTGTCGATTGATGGGAATGATGTGAGAGCCCTGTATAACTG
GGGTCTTGCACTCTCCTTCCGTGCGCAACTAGTTGCAGATATTGGACCAG
AAATGGCTTTTGATGCTGACAAAATATTCTTGGCTGCAATTGATAAGTTT
GATGCTATGATGTCGAAAGGCAATATTTATGCACCCGATGCTCTGTTCAG
ATGGGCTGTGGTGTTGCAGCAAAGATCTCGCTTAAGGCCAAGTAATAGTA
AAGAGAAGGTGAAGTTGCTGCAGCAGGCTAGAAGACTATACGAAGATGCA
CTTCACATGAATTCTGACAATCTCCAAGTAAGAGAAGCGTTGTCGTCTTG
CATGTCAGAACTTAACTATGGTGACTTCTTTTAGTGGTTCCTGACAATAC
AGTATCTGGG
back to top