FC928996

Overview
NameFC928996
Unique NameFC928996
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length439
Libraries
Library NameType
PhII-IIIV1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15016 contig Ccv1_Contig15016:1..439. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionKN0AAH3BG01RM1 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH3BG01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC928996 ID=FC928996|Name=FC928996|organism=Citrus clementina|type=EST|length=439bp
AAGTGTCTCCCTTCTTTAAAGGGTCCCCCCTTGGGGTCCCCCTAAAGTAA
GTTTCCCTGTAGGAAACTTTAGGCTACAAGAAGTTTTGGCATTTGAGATG
CCAATATTGGCTTCGCCAGGCCATCGAGATTCAAATATTTTCTTTTTGAA
TCTCGTGCAAACTCGGACCCTAATTAAGGTAAAGGCCTTACTCTATTCCT
GTCGGAATAGCGGCCTTGGAAGAGGGATACCTTTTTGGTTTTAAGCCTGG
GTGGGTTCCCCTCCGTGGTACCAGATACTCGGGTCCCACTCCGGCCCCGC
TTCGCTCTTTTCTTTATCTCAGGTGTTCCAATTCGGAAAATTGCATAAGT
GATCACTGAACCTTCGTTTGGCCTGTTTGGGTGACTCGTTAATGATGTGG
CATCTGTCCAATCACGTGAGTTTATTCACGGACAATAGC
back to top