FC929001

Overview
NameFC929001
Unique NameFC929001
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length757
Libraries
Library NameType
PhII-IIIV1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9288 contig Ccv1_Contig9288:11..767. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionKN0AAH3BG08RM1 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH3BG08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929001 ID=FC929001|Name=FC929001|organism=Citrus clementina|type=EST|length=757bp
GGCACGAGGATTCGCTGGCAACGGATTATGGAACCATTGATGATCTTTGC
GAGTTGTGCGTTGGCTATGGTGCAATGCCAATTTTGGAGGAAGTGATTTC
AATGAGAATCTCATCTACCAACGAACAGGATGTAGCTGTTAATCAGCATA
CTGCTGCAGCCCTTGCCCGCATTTGCACCTATTGTGAAACTCATAAACAT
TTCAATTACCTATACAAGTTTCTGGTATGGATGAAGTATTCTTATTAAAT
CACCCGGAATAAGAAAAGATGAAGCTTTATATTTTTTTTCGCTGTTGAAG
CATAGTATATTGATGTACCTTATATATGAGCTTTAGAATCCTACTATTTC
CCTCCATTTCTACCATATTTGTCATTGATTTACTTCAAATTTTCTGTCGG
TTCAGGTAATTAAGAAGGACCATGTTGCTGCTGGACTTTCCTGTATTCAA
TTATTTATGAACTCTTCTTCCCAGGAGGAGGCTATCAAACATTTGGAAAA
TGCTAAGATGCATTTTGATGAAGGGCTGTCAGCTCGAGTTAAAGGTGGAG
ATTCTACCAAGCTTGTCACTAAGGGTGTCAGAGGAAAAAGTGCTTCTGAG
AAACTAAGTGAAGAAGGACTTGTCAAGTTTTCTGCTCGGGTATCAATCCA
GGTGGAAGTTATAAAATCTTTTAATGATTCGGATGGACCACAGTGGAGAC
ACTCTCTTTTTGGAAATCCAAATGATCCGGAAACCTTCANGAGGAGGTGT
GAGATTG
back to top