FC929006

Overview
NameFC929006
Unique NameFC929006
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length834
Libraries
Library NameType
PhII-IIIV1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15062 contig Ccv1_Contig15062:24..857. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionKN0AAH3BH03RM1 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH3BH03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929006 ID=FC929006|Name=FC929006|organism=Citrus clementina|type=EST|length=834bp
AAAACGTTAAACAACTACTTGCACATGAGATAGTGTTCTTAGTCTTTTAG
ATAGACTAAGAAATTTCAGCTCGTCCTAATCTTATTAAACGGTTCTTGAT
ATTTCATCATCGACCCCAACTTTGGCTGCAGTGTTGTTTTGATGCCTCGG
ATTTTATGATCATGGGTTGGATCATTTGGATTTCTGATAAGATGATTTCT
CAGCTGGGGTTCTGGGAATTTTATGAGCTTTCTTTTATTCCTTCGAAGGT
AGCTTATATTGTTTGATGTTGGTTTGTTGCAGGTTGGAATTGCTATCTTC
TTTTGGCTCTTTTTCAGGATTCTGCAGTCATCATTTTTCCTTTTTAAAAA
TTTTCGCTTCTCAGATATCAAGGAAGCAGTCACAAGATTTTGCTTGATTT
CTGATTCAGTATCTCAAATTTAGTACAAAATTGGGTATCTGTAAATTTAA
AATTTTAATTCGAAAACATGGGCCTCGCTAGTATGCCGTCCGCATCAGAA
GGAATGCTATGCTTGATTCTAATGAACACTGCTATGTCAATCTCAATCGT
CAAAGGCATATTCAGATCAATACTCAAGGTTGTCGGTTTCCAGCTTGCAG
ACTCATCATCGCCACCGTATTCATATTTCGCATCACCTCAAGTTGTCTCC
GCAGAGCCATATGATGTAAATTTAAGTCCTCCCCTTAGCTATGTTGAGGA
GTTCCGAAACCAGAACCCTGCAATCAAGTATGAAACATTGCTCCATTGTG
AAGATGCAGAGCATGACTGTTCTGTGTGTTTGACCGAGTTTGAGCCTCAA
TCTGATATCAATAACTTGTCTTGTGGACATTTGT
back to top