FC929017

Overview
NameFC929017
Unique NameFC929017
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length697
Libraries
Library NameType
PhII-IIIV1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig155 contig Ccv1_Contig155:172..868. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionKN0AAH1DA08RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1DA08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929017 ID=FC929017|Name=FC929017|organism=Citrus clementina|type=EST|length=697bp
GATACACTTTCTCCAAATCAAGTTCACGGCAATTGGAGTCTACTTGGATC
CTGAAATTTTGAGTCACTTGCAACAGTGGAAGGGCAAACAGGGAAGTTCC
CTTGCACAAGATGATGACTTCTTTGATGCTCTTGTCTCTGCTCCAGTAGA
GAAATTTTTTAGAATTGTTGTGATCAAGGAGATCAAGGGGTCACAATATG
GGGTTCAGTTAGAAAGTGCGGTGAGGGACAGATTGGCCGAAGCTGACAAA
TATGAAGAAGAGGAAGAATCTGCCCTTGAGAAAATCGTTGAATTCTTCCA
ATCCAAGTATTTTAAGAAGGACTCTGTGATTGCTTATCATTTTCCGGCAA
CATCCCCTACTGCTGAGATAGTGTTTACAAGTGAAGGAAAGGAGGACTCA
AAAATCAAAGTGGAGAATGCGAATGTGGTTGAGATGATCAAGAAATGGTA
CTTGGGTGGAGCAAGGGGAGTGTCTCCTACAACAACATCATCTCTAGCCA
ATACTCTCTCAGCTGAGTTATCAAAATGAAGCAGCTCTGCGCTTTCTAAT
AAAAGTGCTTCTTCACTTGGGTTTTGGAATTGCTGTAAATTTGTGGAATT
TGAATGACGTGTTTACCCCGCAACCATGCTTCTATTTTAATGAAAATTTG
CTTTGCTAAGGTCCTTCAAGAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top