FC929028

Overview
NameFC929028
Unique NameFC929028
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length744
Libraries
Library NameType
PhII-IIIV1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9266 contig Ccv1_Contig9266:2..745. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionKN0AAH1DB09RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1DB09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929028 ID=FC929028|Name=FC929028|organism=Citrus clementina|type=EST|length=744bp
TTTTGAACAAGAAAAGTACACGAATGGAATTCTTTTAGGTTATATCTGAT
ATGCAATCTTGTATTACAAGGCAGCAACAAATCTCAATTCACTATACTCC
GAGAGCCACCAGTGTAATAGCTCACACGTCACAACTTATCTAGACTAGCT
TTGGACCAATCTGAAATTATATTTTGGGTGAATAACATTCCAACCCACCT
TTTGTATTTTTTCACTAAAAAAAAACCTCGTGCCGAATTCGGCACGATGC
CTCGTGCCTAATTGGCACGAGGCACATGTTTACATAGTCAAATGCAAGGA
ACTTATGGCCCTCCCAGATGATATGAACAGACTCAACTCTCTTCGACATT
TATGGATAAAATGATTGTCCAAGTATTGTCTCATTTCCAGAGGAAGGTTT
TCCAATCAGTCTTACAGTACTTGTAATTGGAGAAGTCAAAATCTACAGAG
CACTGATCCAGTGGGGATTGCACAGGCTGACCTCTCTTAGACGCCTCTGT
ATTTATAGATGTGATGATGCAGAGTGTTTCCCATACAAAGAAACGGCAAT
CATGTTGCCCGCTTCTCTAACTCATTTGCACCTTCGGAAATTGTCCAAAT
TGAAATACCTATCTTCAATGGCTTTTCAAAGCCTTGCTTCTCTTAAATAT
TTGTGGCTTGAGAGTTGCCTAAATCTCACATCATTTCCAAAGGAGGGCCT
TCCATCCTCACTTTTGGAGTTAAGAATTGAAGATTGTCCGATGC
back to top