FC929082

Overview
NameFC929082
Unique NameFC929082
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length867
Libraries
Library NameType
PhII-IIIV1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9253 contig Ccv1_Contig9253:2..868. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionKN0AAH3CB11RM1 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH3CB11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929082 ID=FC929082|Name=FC929082|organism=Citrus clementina|type=EST|length=867bp
ATTATGCATAGCAGATTAGTCTGTAAATTGAGAGTTTTGCTGCTCTACCC
TCATATACCAATCGCAAATTTTTGCATTCAAAATGTGAATACATTGAAAT
TGGTTTTGTGATCTTGTATGCTGAGTGAGCCAGAAGAATGCATTTGGAAT
ACTGGTGGATTTGAAGACTCTTCTGCCTGATGAATGGCTTTTCTTCACTC
AGTTAATTAGAAATGTAAATTAGAAATAAAAGAATACCCTAATTGTGCTA
CAAATTTGGCCTCACCTACTTAACTCTCTTGACTTCAAGCATTCAAGTTT
TATTATTACATACATATTCACTGCAGCTAAGTTTTCTTATAATATTCCAG
GAACCTGAGATATTTAGTTAGAACGGAACATTATGCTTTATGCAAGCATG
AAGTTTTGATTGATATGAAATAGGATGGAAATGACTCGGCATTAAGTCTT
AACTTGTCATTGTTCACTTGGACTACCACGGAAACTGACTATGACTTCCC
ACTTACAAGAAGCGAAGCATTATTTTTGCAGAGTGCAGAAAGTATGGCGT
TTGTTCCATGACCACGCTCATGATCTGTGGGACTCTCTGGTCCATACTTC
TTGCTTGCTTTGGGTTTTGCCCGGACAAATAATGTTTGAAGTAGCTGTCA
TAAGTGTGCGGGGTTGCTCCTTGGCTGCAACCATATGCTAAAGAAATGTT
CTCATATTAGATTTATACATTCAAGTAAATGCAGTCTTCCAAGATATGTA
ATAACTGTATGAATTTACTCTCACAATGGTTCTATTGTTGTAATATCAAT
TGACTGTAATATAGCTTCCTTGATTCGGAAGTGGATTAACTATTAACTAG
CAAAAAAAAAAAAAAAA
back to top