FC929088

Overview
NameFC929088
Unique NameFC929088
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length802
Libraries
Library NameType
PhII-IIIV1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9268 contig Ccv1_Contig9268:11..812. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionKN0AAH1DF05RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1DF05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929088 ID=FC929088|Name=FC929088|organism=Citrus clementina|type=EST|length=802bp
GGCACGAGGCACAACTCACTAGCAGTCTCCCACCGCGTAAGTAAGAAGCT
CAATCTCAAAGCAATGGATCGGAAGACTGTACTTGCATTTGCATTGATGT
GCGTCATTGTCGCTGGTGTCGGCGGCCAATCCCCGGCTGCTGCACCAACA
ACAGCTCCTGCAAAGGGTAGCAGCCCAGCAAAAGCTCCATCCACAGCTCC
TGCAAATGGTGGTGGCAGCCCAGCAAAAGCCCCAGCCACAGCTCCTGCAA
AGGGCGGCAGCCCAGCAAAAGCCCCATCCACAACTCCTGCAAAGGGCGGC
AGCCCAGCAAAAGCCCCATCTACAGCTCCAGTGAAAGCCCCCGCTAAGCC
CAAATCGCCAGCTCCCGCCGCTGTTCCAGCAGCTGCTCCGTCTAAACAGG
CTGTCCCCGCTCCGGCGGCAGCTCCCACATCGACTCCTCCGGCAGCAGCT
CCCACATCGACTCCTCCGGCGGCTACTCCAGTGAGTTCGCCTCCAGCTCC
GGTTCCAGAAGCAAAATCACCTCCAGCACCTACTCCTAAAGCTGCGCCGG
AGACTTCACCAGCGGCTCCATTGGCTTCGCCCCCTAAAGCCGAGGTGCCT
GCGCCGGCTCACAGCAAGAAGAAGTCAAAGAAGCACAATGCCCCAGCTCC
TTCCCCGGCTTTGTTGGGCCCGCCAGCACCACCGTCGGAGGCTCCGGGAC
CGAGCGCCGACTCAATGTCTCCCGGTCCATCTGTCGCCGACGACGAGAGC
GGCGCAGAAACGATCCAGAGTGTGCAGAAGATGATGGGCGGGTTGGCATT
GG
back to top