FC929098

Overview
NameFC929098
Unique NameFC929098
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length520
Libraries
Library NameType
PhII-IIIV1cdna_library
Alignments
Feature NameTypeLocationAnalysis
FC929098_ssr133 microsatellite FC929098_ssr133:133..144.
FC929098_ssr270 microsatellite FC929098_ssr270:270..281.
Ccv1_Contig15008 contig Ccv1_Contig15008:1..520. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionKN0AAH3CC04RM1 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH3CC04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929098 ID=FC929098|Name=FC929098|organism=Citrus clementina|type=EST|length=520bp
AAACTCTTATCAATGAGTTACCATCCTGTTCCTCATGATTCTCCTTGTCC
CCCTCCAGGGCAGCCACCGTCACCATATCCTCCACAGCCAGACTTTCCAC
CCCCACAGCCGCCAGTGGGGCAGCCATTTCCTCCACCACCACCACCTGGC
TATCAGGGATACTTCAATGAAGTGTACCCTCCACCACCACCGGCTCCACA
GCCTTCGCAGGACGATCACCAAAATGACACTGGATGCTGTTCATGCCTGA
AGGGATGTTTGGCTGCACTCTGCTGCTGCTGTGTATTGGAGGAATTGTGC
TTCTAGGCCTTGCATGATTCTTCTCACTGGTTTTATGTGTGTTTTTTGTT
ACTTTTACTGGGATATTTCAGACAATTATGAACGACAGTAGAAAATAGTA
TTTACACATCCTTTAGGGACGCCAAAATGTTAAAATCAAACTTGTGTTGT
TACAAACTGTCAATTTGAACTGTTGTACATTTGCATCTGTTAAAAAAAAA
AAAAAAAAAAAAAAAAAAAA
back to top