FC929099

Overview
NameFC929099
Unique NameFC929099
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length282
Libraries
Library NameType
PhII-IIIV1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15035 contig Ccv1_Contig15035:1..282. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionKN0AAH3CC05RM1 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH3CC05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929099 ID=FC929099|Name=FC929099|organism=Citrus clementina|type=EST|length=282bp
AGGAATCGTTCTACAGTGAATTTAACCGAGACGTTTGATAAAAAATTAAC
GGCTCCAGCTCCATCACCTAGGACTTATGATGCTCTCAAAAAGCATTTCT
GATGACACCTATCATCATATGTAGTGCAACCAAATCTGCATTCATCCAAG
ATGATTGATTGTTGCTATTTGTACGTAATTCTCCTACGTTTCTAAGTGAT
TTATATGTTCTCCGTAGAAGCCATGTAAACTAGTTATTTCCTATCCAATA
AATCAATTTTTATTTAAAAAAAAAAAAAAAAA
back to top