FC929285

Overview
NameFC929285
Unique NameFC929285
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length433
Libraries
Library NameType
PhII-IIIV1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9788 contig Ccv1_Contig9788:22..454. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionKN0AAH2AG03RM1 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH2AG03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929285 ID=FC929285|Name=FC929285|organism=Citrus clementina|type=EST|length=433bp
AAGCAACTTAACTACTTTCGAACTTTGATTCCCGTAAGCAGAGATCTTTC
TGATTTGAAGAACATGGAAACCACCTGCGCAGGTAATAACTGGTCAGAGG
GTCTTCTGCTTCCTCCGTTTGGCAGTATTGCTGATGATGATGTCATGAAC
GACAATCTTGATTTTCTTAATGTCCCCCAATATGGAAGAAACCCCGACTA
CATGGGTTAAGTGCAGCACTGCTTTTTTTTTTTTCTGTTTTGTTTAATTA
AATAAATGATAGGTATACTATTACCTATCAATCATGACAATGTTTTAGTA
TGGTTTAGTTCAACTTATAAGATTTCTTGAGACGTACAAGCAATCTTTTT
GTTTACTTTTGAGCTAAGTATTTTCCTGAAAAAGGAAATAAATCAATAAA
AGTTATTGTGTGTGTCAAAAAAAAAAAAAAAAA
back to top