FC929343

Overview
NameFC929343
Unique NameFC929343
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length656
Libraries
Library NameType
PhII-IIIV1cdna_library
Alignments
Feature NameTypeLocationAnalysis
FC929343_ssr16 microsatellite FC929343_ssr16:16..27.
FC929343_ssr62 microsatellite FC929343_ssr62:62..76.
FC929343_ssr138 microsatellite FC929343_ssr138:138..158.
Ccv1_Contig531 contig Ccv1_Contig531:205..860. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionKN0AAH2BA01RM1 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH2BA01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929343 ID=FC929343|Name=FC929343|organism=Citrus clementina|type=EST|length=656bp
GGCACGAGGGAGCAGGCAGCAGCAGCAGTTGAAATATCATCATCGCAACA
GGACCAGCAAGAGCAGCAGCAGCAGCCACAAGTTGATGTTAAGCCTCCGA
GATCAGTCAACACTACCATTGAAAGAAGCCGATCCAACGGCGGCGGCGGC
GGCGGCGGCGCTGGAGCAAGAGGGTACCGCACCGGCAGAGTCTCTCCGGC
AATCGAACCTCCTTCTCCTAGGGTTTCTGCATGTGGGTTCTGCAGCGCTT
TTGCTAATAAACCCCCCAAGAATAACACTCATGCCAAGAGAACCGGTAAG
CGTAGATCACGACCGTTCTAGATATCACATGTTCTGAGGCCACCACCGGA
AGTGGAATATTCCGATGAGCTTGGGAATATTGTTTATTATTGTTTGTGCA
TTTATAGGTTGGCAGGGTTTTGCAGTTCGGTTCGGTTAAATCCAGTTTAG
TTTATCTCACGAACAGAAGTGAGATGTAGGGAGTTTTGAAACAAGAACGA
TAGTGTTATTTTTTAAATTTTAACTTTTGCCTTTTAGATCATGGATTTTT
TGTTCTGTTTTTATGTTCTTGTGGTTCTGATGGGATGTAATTATGTAAAT
ATTGTTTGTTTCTCGAGAAATTCTCATCTTTGTACATAGAAAAAAAAAAA
AAAAAA
back to top