FC929353

Overview
NameFC929353
Unique NameFC929353
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length446
Libraries
Library NameType
PhII-IIIV1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAH2BA12RM1 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH2BA12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929353 ID=FC929353|Name=FC929353|organism=Citrus clementina|type=EST|length=446bp
GGCACGAGGCCAAATGTGAAGAAGTGATCGACAAGTCACATGTGCACCTT
GTGCCACCACCTGCCGGTCAATCTCCAAACCCATTGCCAACCACAGATCA
ACAGAGCACCAGTAATGGACAGGCAGCTGCACCTTCTACTGCAAAAACGG
CTCCGTCCAAGTCCATTGCAGCCTCAGCCCAGCAACTTGACTCTGTTCTT
CGTGTAGCATGTTCATTGCTTGTGTTAATGTGTTTGCTCCTATCATCCGA
TTAGTCCTCACCCGCTCTTGTAAATCTGTTGTCTATTCTTGTCAACCTCT
CCCATCTTACAAAACAGCTCAGTTTTTCTATTAGGCCATTTGTATTGATT
GGGGTTGGTGGAAGATTTCTTTATGGGTATGTCAACTTTTGGTTCATTTA
TGTTTTTATTAATGCATTATTTTTAAGGCTAAAAAAAAAAAAAAAA
back to top