FC929464

Overview
NameFC929464
Unique NameFC929464
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length364
Libraries
Library NameType
PhII-IIIV1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig13437 contig Ccv1_Contig13437:935..1298. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionKN0AAH2CD11RM1 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH2CD11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929464 ID=FC929464|Name=FC929464|organism=Citrus clementina|type=EST|length=364bp
GACATTCCAATACTGCCAAAAGACACCCAACCTGGGTTATTGAGGACCAA
GGATGGAGCCAAAAAGCTAATGGACTTGGGTTTACAATTCATTCCCATGG
ATCAAATCATCAAGGACTCTGTCGAGAGTTTGAAGGCCAAAGGATTTATC
TCTTGAATGAAAGCTGCAACGTGTCAGCAGCTGCTGATGAACCCATCCGC
TTTATACAAGCAGAGGGCTGAGAGCTATAGTATAATTAGATAATTTGGTT
AAATGTTGTCTCTTTGTAATTTTCTGTGAAATATCGTTGAGATGAGCCAC
TGTCAGGAAGTCGACAACTTAATAAATAAAATATCTTTCTAGAAAAAAAA
AAAAAAAAAAAAAA
back to top