FC929483

Overview
NameFC929483
Unique NameFC929483
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length848
Libraries
Library NameType
PhII-IIIV1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15046 contig Ccv1_Contig15046:1..848. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionKN0AAH2CF07RM1 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH2CF07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929483 ID=FC929483|Name=FC929483|organism=Citrus clementina|type=EST|length=848bp
GAGAGATGAGGCAATTGGGTAAGACGCTGAATAATCTTTCTTCAACACTC
TGTAATTTTGCTTTTCTTCTTTTTTCTTTTTTTTTTTAGTTTCTGAATAT
GAAATCTTAATTTGGTGCAGAAAAGCATTGCCTATAGCCATTGCAGTTGC
AGCTGTGGCACTTGCTGGTCTATACTTTTACCTAAACAGTGCTTTCTAGG
ATTCATAACAGCAACTCTCCCTCTTTGTGGGGAGAACAGCATTGCTCTTG
TAATTCTATTTCATTCATGGGTTTCCTATTCACTTGCACTACACTTCTTT
TGCGCCCATACCACATTGCAAGAGTTGAACTCCTCTTTTTCATTTAAAAT
AAAGCACTCAATGATATCTATTATGACATGCCAAAAATTTGCATTTCCTC
TATGGATTTCCTCCGCGAAGCAAATGTAAAAAATTGTAAATACATCACAT
CAACTTTAATTTCCCTATAATACAACTCATGCAGATTACATGATCGAAAA
CCCTCCTCCAAACTGTGTTTATTAGGTCACTACACTTGCTTCCAAATTCT
ATGGTGAATAATGGATCCGACGGTGCCCTACCAGACACCTATTTCTCCGG
TGCAAGCTGATTAGTGGTTGAGATATTACTCGGCCAAGATCAGCATGACA
AAGTTGATAGAGAACAGAAAGGGATTTCTTGTTTAATTTACCAGATAAGT
GAAAGTTGTAAATTTACATACTTTAGTTACATGTACCGAGTTATCATTCT
TGCAAGACAAAGGATCCTTCAATTCTCTTCTCAAAGAACTGCTGTGGAGG
GAAATTCAAGGGGGAGAACATGTCACTATAACTAGAACTAGGCGCCGG
back to top