FC929485

Overview
NameFC929485
Unique NameFC929485
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length261
Libraries
Library NameType
PhII-IIIV1cdna_library
Alignments
Feature NameTypeLocationAnalysis
FC929485_ssr12 microsatellite FC929485_ssr12:12..21.
Ccv1_Contig14184 contig Ccv1_Contig14184:128..388. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionKN0AAH2CF09RM1 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH2CF09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929485 ID=FC929485|Name=FC929485|organism=Citrus clementina|type=EST|length=261bp
GAGCTTTTTCATCTCTCTCTCAGTCCCTCTCAAAGGCCTCATCTTAGCTG
CTGTGTGTGTTGTGACACACTTTTCTCGGACCCAAACAAACAAGTATTTG
TTATTATTATCTCTTCTCGAATCTTCTTTTGATCATTCATGGATGGCTGT
TGTGGTGCTTTTAGCTCTCTTCCTTGGCTTCACTGGGCATTCCACTGCAA
GCTGGTGTGTTTGCAAAGATGGAGGGGGTGACCCAGTTTTACAAAGAGCT
TTGAACTATGC
back to top