FC929505

Overview
NameFC929505
Unique NameFC929505
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length579
Libraries
Library NameType
PhII-IIIV1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9279 contig Ccv1_Contig9279:3..581. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionKN0AAH2CH08RM1 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH2CH08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929505 ID=FC929505|Name=FC929505|organism=Citrus clementina|type=EST|length=579bp
ACGCAGTCTCCCCCTCCTCCCTCGAAGATTTAGTGTCTACAATATCGGTT
CAATATTTTCCTATGGCTTTCACTTTTTCAGGGTTTCGACTCAATCAATC
TTCGTTTTTGATACTTCTTTGTAAATCAAGAACGGATTTCTGTTTATTTT
TGCGTTTAATCGTTTATATCATTCGATGATGCTGTGGCGAAATGATATCA
TGTGATGAGGAATTAACTGCAACAAAATGATCGATTATCATCGTGATTAC
CGTGTATTTAAGTCTCTGATGATTTTATTTCGTCGATATTATGCTACCCA
AAAAATCTTTTCTTTCAAATCTTGAAATACAAGATTTGTTTTCCCCGGTC
ATCTTTTTAATTTCTTCAAATTTCTCGTTTTCAGTTTTTGATAAATTTCG
CCGGAGATATGATGATAAATCTTTTGGTCCGTGTTTCTGATTTAACCGTG
ACCGATAACCTTTTGCCAATATCTGATCTCTTCTTCTACGTGTGTCGATT
CTTTGCAATTACTTTGCTTTAATTTATATTGGAGTAAAGCCCTAAATTTT
GGTATTCCAACCAAAAAAAAAAAAAAAAA
back to top