FC929515

Overview
NameFC929515
Unique NameFC929515
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length451
Libraries
Library NameType
PhII-IIIV1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9897 contig Ccv1_Contig9897:84..534. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionKN0AAH1AA08RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1AA08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929515 ID=FC929515|Name=FC929515|organism=Citrus clementina|type=EST|length=451bp
TTGAGTTTTGAATACGGTTCACCCGAAGCTAGCAAAGATCTTTTCTCTTT
CTGACTTGAAGATCATGGAAACTCCTTGCGCAGGTAATAACGATTGGACT
GAAAGTTGGGGTGACCCATATCTTGGAAGTGTTGCTGATGATGAGGTTGT
GGATCACAATCTTGATTTTCTTCTGATTTCTCAATATAGAGGGAACCCTA
ATCACGCTGGTTAAATATAAACAGAGTTACTCTTTTGGATGTGTTATATG
TAATAATTGAATAAATGGTGGGCACCGTTCGTTGTCATTACCAGTCGATG
GTTTCGCGTGAATGCCAGTTTGTTTTAGTTTAATTAGTAAGATCTCTTGA
GATATGCAAGAGATTTTCTTTGTTTGTATTCATGCAATTTGTCTTTCTTA
ATAAATAAAATTATTGTGCATAGTATGTAAAAAAAAAAAAAAAAAAAAAA
A
back to top