FC929517

Overview
NameFC929517
Unique NameFC929517
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length579
Libraries
Library NameType
PhII-IIIV1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAH1AA10RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1AA10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929517 ID=FC929517; Name=FC929517; organism=Citrus clementina; type=EST; length=579bp
ACGCAGTCTCCCCCTCCTCCCTCGAAGATTTAGTGTCTACAATATCGGTT
CAATATTTTCCTATGGCTTTCACTTTTTCAGGGTTTCGACTCAATCAATC
TTCGTTTTTGATACTTCTTTGTAAATCAAGAACGGATTTCTGTTTATTTT
TGCGTTTAATCGTTTATATCATTCGATGATGCTGTGGCGAAATGATATCA
TGTGATGAGGAATTAACTGCAACAAAATGATCGATTATCATCGTGATTAC
CGTGTATTTAAGTCTCTGATGATTTTATTTCGTCGATATTATGCTACCCA
AAAAATCTTTTCTTTCAAATCTTGAAATACAAGATTTGTTTTCCCCGGTC
ATCTTTTTAATTTCTTCAAATTTCTCGTTTTCAGTTTTTGATAAATTTCG
CCGGAGATATGATGATAAATCTTTTGGTCCGTGTTTCTGATTTAACCGTG
ACCGATAACCTTTTGCCAATATCTGATCTCTTCTTCTACGTGTGTCGATT
CTTTGCAATTACTTTGCTTTAATTTATATTGGAGTAAAGCCCTAAATTTT
GGTATTCCAACCAAAAAAAAAAAAAAAAA
back to top