FC929518

Overview
NameFC929518
Unique NameFC929518
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length803
Libraries
Library NameType
PhII-IIIV1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAH1AA11RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1AA11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929518 ID=FC929518; Name=FC929518; organism=Citrus clementina; type=EST; length=803bp
ATTATGCATAGCAGATTAGTCTGTAAATTGAGAGTTTTGCTGCTCTACCC
TCATATACCAATCGCAAATTTTTGCATTCAAAATGTGAATACATTGAAAT
TGGTTTTGTGATCTTGTATGCTGAGTGAGCCAGAAGAATGCATTTGGAAT
ACTGGTGGATTTGAAGACTCTTCTGCCTGATGAATGGCTTTTCTTCACTC
AGTTAATTAGAAATGTAAATTAGAAATAAAAGAATACCCTAATTGTGCTA
CAAATTTGGCCTCACCTACTTAACTCTCTTGACTTCAAGCATTCAAGTTT
TATTATTACATACATATTCACTGCAGCTAAGTTTTCTTATAATATTCCAG
GAACCTGAGATATTTAGTTAGAACGGAACATTATGCTTTATGCAAGCATG
AAGTTTTGATTGATATGAAATAGGATGGAAATGACTCGGCATTAAGTCTT
AACTTGTCATTGTTCACTTGGACTACCACGGAAACTGACTATGACTTCCC
ACTTACAAGAAGCGAAGCATTATTTTTGCAGAGTGCAGAAAGTATGGCGT
TTGTTCCATGACCACGCTCATGATCTGTGGGACTCTCTGGTCCATACTTC
TTGCTTGCTTTGGGTTTTGCCCGGACAAATAATGTTTGAAGTAGCTGTCA
TAAGTGTGCGGGGTTGCTCCTTGGCTGCAACCATATGCTAAAGAAATGTT
CTCATATTAGATTTATACATTCAAGTAAATGCAGTCTTCCAAGATATGTA
ATAACTGTATGAATTTACTCTCACAATGGTTCTATTTGTGTAAATATCAT
TGA
back to top