FC929519

Overview
NameFC929519
Unique NameFC929519
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length831
Libraries
Library NameType
PhII-IIIV1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAH1AA12RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1AA12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929519 ID=FC929519; Name=FC929519; organism=Citrus clementina; type=EST; length=831bp
GGCACGAGGCGGCACGAGGGTTCAGTATCTGAGGTGGATCTATGCATGCT
TCATAGCTTGTATCAGGGTTTTCGTTATTGTTTATCGAGATTCCAAAAAA
AATTTCTACTTAAAGGGCGTGATCTTAGTGAGTCAATTTACCGTTATTGA
ATTGAATTTAGAGTTAATATTTTAGTCTTTTAATCATAGTGCACTGCTTT
CTACTGATGAATCTAGGATTGTGGATGGATACTGGTTTATTGGTTTTACA
TTATGAGAGTAATTAGTTATCGTAATTTAACTTTCTCACAAAGACAGCAA
AGTTGTGGGACTCATTTTATTTTTCAATTAAGAATTAACTTCAATAATTA
CCTCCCTGAGGTTTGCCTTAACCACAAAATATAGAGCTAGTTTTTTTTTT
GGCAAAATATAGAGCTAGTTTTGTTCATTAACGGATGCCCCCATGTCTGT
CCGCGGGTGCTTCATCGGTAAAGCTTCGCTATTAAGGGCAATACAGTAAA
ATCACTGGAGCACTGAAAGATCTCGCGACCGCACTCCTCTAATTGTCCTT
TTCTCATTCAACAAAGTACAAAATTCGAATTTCAAACACGTATTACGCAG
TAAGCTCAAAGCTCGAATGAGAATTGGTGTGTTTCTGGTCCGTAGGTTCT
TGACTGGTTGTGGGACCCTTTGAAAAAACCAAAGGCAGATCTGACGGTTT
CAATATGTACTTTTATTTACGGTAATTTCCACTGCAGCCCCTGTTGTTTG
TTGAAAACACCAAAAATATTGTTAGTTCCCATTTCATATGAAATAAATCC
TTATATCTCTTATTTAAAAAAAAAAAAAAAA
back to top