FC929520

Overview
NameFC929520
Unique NameFC929520
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length625
Libraries
Library NameType
PhII-IIIV1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionKN0AAH1AB01RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1AB01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929520 ID=FC929520; Name=FC929520; organism=Citrus clementina; type=EST; length=625bp
ATTTTGTGTCAAAATTGTTTCCGAAGCAAGATCTGGTTGCTACATTGAAG
AAGATGGCAATGGGGCAGACAATTTATGGACCAATTATGACTGTCGTGTT
CTTATCACTGAATGCAAGTTTACAAGGTGAAAGTGGAGAAGAGATTGTTG
CTCGATTAAAACGAGACTTGCTCCCTACCATGTTCAAGGGTGTCATGTAC
TGGCCTGTATGTGATTTTATCACATTCAGATTCATCCCTGTCCATTTGCA
GCCATTGGTGAGCAATTCATTTTCATATCTATGGACTATCTATCTGACGT
ATACGGCGAGTCTAGAAAAAGCTGTCACAACTGCAAGCTGATTGGTTCAG
TGTTCCCTCTATCCATCTCACGTTCAAGCCCAAGATCTACCTTAGATACT
CTCAGCTGATGGTTGACGCAGAACTGCTATGAACTTGATCCATTGCTCAT
GTAGACCAAGCAGCGCCCATTAATATTTTGTTCTTTTCTCTTAGTGGTAT
TATTTACTAGATAATGCAATTGGACAACATATCAGAGGTTGTAAAGTAGT
GGGTTGATGACGTTATTTTAGTGGGCAATTTCCACAGTAAAAAACTGCTC
TTGATCACAAAAAAAAAAAAAAAAA
back to top