FC929524

Overview
NameFC929524
Unique NameFC929524
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length625
Libraries
Library NameType
PhII-IIIV1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig766 contig Ccv1_Contig766:161..785. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionKN0AAH1AB07RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1AB07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929524 ID=FC929524|Name=FC929524|organism=Citrus clementina|type=EST|length=625bp
ATTTTGTGTCAAAATTGTTTCCGAAGCAAGATCTGGTTGCTACATTGAAG
AAGATGGCAATGGGGCAGACAATTTATGGACCAATTATGACTGTCGTGTT
CTTATCACTGAATGCAAGTTTACAAGGTGAAAGTGGAGAAGAGATTGTTG
CTCGATTAAAACGAGACTTGCTCCCTACCATGTTCAAGGGTGTCATGTAC
TGGCCTGTATGTGATTTTATCACATTCAGATTCATCCCTGTCCATTTGCA
GCCATTGGTGAGCAATTCATTTTCATATCTATGGACTATCTATCTGACGT
ATACGGCGAGTCTAGAAAAAGCTGTCACAACTGCAAGCTGATTGGTTCAG
TGTTCCCTCTATCCATCTCACGTTCAAGCCCAAGATCTACCTTAGATACT
CTCAGCTGATGGTTGACGCAGAACTGCTATGAACTTGATCCATTGCTCAT
GTAGACCAAGCAGCGCCCATTAATATTTTGTTCTTTTCTCTTAGTGGTAT
TATTTACTAGATAATGCAATTGGACAACATATCAGAGGTTGTAAAGTAGT
GGGTTGATGACGTTATTTTAGTGGGCAATTTCCACAGTAAAAAACTGCTC
TTGATCACAAAAAAAAAAAAAAAAA
back to top