FC929532

Overview
NameFC929532
Unique NameFC929532
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length451
Libraries
Library NameType
PhII-IIIV1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAH1AC03RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1AC03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929532 ID=FC929532; Name=FC929532; organism=Citrus clementina; type=EST; length=451bp
TTGAGTTTTGAATACGGTTCACCCGAAGCTAGCAAAGATCTTTTCTCTTT
CTGACTTGAAGATCATGGAAACTCCTTGCGCAGGTAATAACGATTGGACT
GAAAGTTGGGGTGACCCATATCTTGGAAGTGTTGCTGATGATGAGGTTGT
GGATCACAATCTTGATTTTCTTCTGATTTCTCAATATAGAGGGAACCCTA
ATCACGCTGGTTAAATATAAACAGAGTTACTCTTTTGGATGTGTTATATG
TAATAATTGAATAAATGGTGGGCACCGTTCGTTGTCATTACCAGTCGATG
GTTTCGCGTGAATGCCAGTTTGTTTTAGTTTAATTAGTAAGATCTCTTGA
GATATGCAAGAGATTTTCTTTGTTTGTATTCATGCAATTTGTCTTTCTTA
ATAAATAAAATTATTGTGCATAGTATGTAAAAAAAAAAAAAAAAAAAAAA
A
back to top