FC929566

Overview
NameFC929566
Unique NameFC929566
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length266
Libraries
Library NameType
PhII-IIIV1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10129 contig Ccv1_Contig10129:225..490. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionKN0AAH2DB06RM1 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH2DB06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929566 ID=FC929566|Name=FC929566|organism=Citrus clementina|type=EST|length=266bp
GGCACGAGGCCTGAGTGCTCTGTTGTAAGCGCCCTTGATGGTTTGTTTGG
TTTTATGTATGTGATTCTGGGATAGTCCTAAGTGTTTCTGTTATGTGCTT
GCAACTACTATCTGCCGTTATTTTGTCTGCGGCACGATTGGTGCAATAAT
ATGTCATGTTGTTATTAGTTGTAATAGGATATTTATCCATGTCTGCCGGA
TATTTTGTAAGCTTTATAATAGTTGTGAACCGTGCTTTTGCAGCTATTAA
TTAAAAAAAAAAAAAA
back to top