FC929575

Overview
NameFC929575
Unique NameFC929575
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length831
Libraries
Library NameType
PhII-IIIV1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9254 contig Ccv1_Contig9254:11..841. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionKN0AAH1AE03RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1AE03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929575 ID=FC929575|Name=FC929575|organism=Citrus clementina|type=EST|length=831bp
GGCACGAGGCGGCACGAGGGTTCAGTATCTGAGGTGGATCTATGCATGCT
TCATAGCTTGTATCAGGGTTTTCGTTATTGTTTATCGAGATTCCAAAAAA
AATTTCTACTTAAAGGGCGTGATCTTAGTGAGTCAATTTACCGTTATTGA
ATTGAATTTAGAGTTAATATTTTAGTCTTTTAATCATAGTGCACTGCTTT
CTACTGATGAATCTAGGATTGTGGATGGATACTGGTTTATTGGTTTTACA
TTATGAGAGTAATTAGTTATCGTAATTTAACTTTCTCACAAAGACAGCAA
AGTTGTGGGACTCATTTTATTTTTCAATTAAGAATTAACTTCAATAATTA
CCTCCCTGAGGTTTGCCTTAACCACAAAATATAGAGCTAGTTTTTTTTTT
GGCAAAATATAGAGCTAGTTTTGTTCATTAACGGATGCCCCCATGTCTGT
CCGCGGGTGCTTCATCGGTAAAGCTTCGCTATTAAGGGCAATACAGTAAA
ATCACTGGAGCACTGAAAGATCTCGCGACCGCACTCCTCTAATTGTCCTT
TTCTCATTCAACAAAGTACAAAATTCGAATTTCAAACACGTATTACGCAG
TAAGCTCAAAGCTCGAATGAGAATTGGTGTGTTTCTGGTCCGTAGGTTCT
TGACTGGTTGTGGGACCCTTTGAAAAAACCAAAGGCAGATCTGACGGTTT
CAATATGTACTTTTATTTAGGGTAATTTCCACTGCAGCCCCTGTTGTTTG
TTGAAAACACCAAAAATATTGTTAGTTCCCATTTCATATGAAATAAATCC
TTATATCTCTTATTTAAAAAAAAAAAAAAAA
back to top