FC929744

Overview
NameFC929744
Unique NameFC929744
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length477
Libraries
Library NameType
PhII-IIIV1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9279 contig Ccv1_Contig9279:3..479. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionKN0AAH3AB03RM1 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH3AB03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929744 ID=FC929744; Name=FC929744; organism=Citrus clementina; type=EST; length=477bp
ACGCAGTCTCCCCCTCCTCCCTCGAAGATTTAGTGTCTACAATATCGGTT
CAATATTTTCCTATGGCTTTCACTTTTTCAGGGTTTCGACTCAATCAATC
TTCGTTTTTGATACTTCTTTGTAAATCAAGAACGGATTTCTGTTTATTTT
TGCGTTTAATCGTTTATATCATTCGATGATGCTGTGGCGAAATGATATCA
TGTGATGAGGAATTAACTGCAACAAAATGATCGATTATCATCGTGATTAC
CGTGTATTTAAGTCTCTGATGATTTTATTTCGTCGATATTATGCTACCCA
AAAAATCTTTTCTTTCAAATCTTGAAATACAAGATTTGTTTTCCCCGGTC
ATCTTTTTAATTTCTTCAAATTTCTCGTTTTCAGTTTTTGATAAATTTCG
CCGGAGATATGATGATAAATCTTTTGGTCCGTGTTTCTGATTTATCAGTG
AACAATAACCTTTTGCCAATATCTGAT
back to top