FC929818

Overview
NameFC929818
Unique NameFC929818
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length576
Libraries
Library NameType
PhII-IIIV1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAH3AF01RM1 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH3AF01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929818 ID=FC929818; Name=FC929818; organism=Citrus clementina; type=EST; length=576bp
TAACTACTTTCGAACTTTGATTCCCGTAAGCAGAGATCTTTCTGATTTGA
AGAACATGGAAACCACCTGCGCAGGTAATAACTGGTCAGAGGGTCTTCTG
CTTCCTCCGTTTGGCAGTATTGCTGATGATGATGTCATGAACGACAATCT
TGATTTTCTTAATGTCCCCCAATATGGAAGAAACCCCGACTACATGGGTT
AAGTGCAGCACTGCTTTTTTTTTTTTTCTGTTTTGTTTAATTAAATAAAT
GATAGGTATACTATTACCTATCAATCATGACAATGTTTTAGTATGGTTTA
GTTCAACTTATAAGATTTCTTGAGACGTACAAGCAATCTTTTTGTTTACT
TTTGAGCTAAGTATTTTCCTGAAAAAGGAAATAAATCAATAAAAGTTATT
GTGTGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAACTCGACCTCGTGCCG
AATTCGGCACGAGGGTTGTTGTATGGAGATTTTGATAGATTGAAGGATAC
TTTGTGGTGATTAACACAATGGGAGGGCTTTGCCCGAGGAGTCCAAATGT
AAATAAGGCTCCCGGTGAAAGCTTTC
back to top