FC929849

Overview
NameFC929849
Unique NameFC929849
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length788
Libraries
Library NameType
PostHarvC1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC34001B01EF PostHarvC1 Citrus clementina cDNA clone C34001B01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929849 ID=FC929849|Name=FC929849|organism=Citrus clementina|type=EST|length=788bp
GGCGCTCAAAATTGGAACGTTGGACAAGCCATAAGGAGAGGGATTTCAAT
ATCAACAGTAAGTCGTCATCTTCCCTGAAGTTTAAAGAAATTAATAAGAA
TAGTAATGGCAGAACTTTAGAGACCAGCAAAATTCCAGAGGAACCTGCTA
CAGCAGTTGAGCCTGTTGATAAGCAAAACCCCATGGCTGATAAGAAAGAT
GGTAGTAATCCTGAGAATACAAAACCAGTGGACGATCGGCACCTTGACAC
AGTTGAGAAGCTGAAGAAGCGAAGTGAGCGATTCAAGCTCCCAATGCCAA
GTGAGAAGGATACGTTGGCAATAAAGAAAATGGAGCGTGAACCTCTACCT
TCTACCAAAAGTGAGACTGCAGCAGGCTCAGAAATCAAACAGGAGCGGCC
AGCCCGGAAACGAAGGTGGATCAGTAACTAAAGTTGGGAAAAGTTATTCC
CCGCACTATTTTTGAATTATTGAACCCTGAAGTTGTTATCATGCCCTATG
CTTTGAAATGGCTTAAATAGGGTTCTTAGGATATGCAATGTACCTCAGCT
ATAGTTTTATAATTTTGTAACCATGCAGCCACCATATAACTTTTTATATT
ATGTGTATATACAATGGGGATTGTAACTCTGTAACTGGTCACTAGTGGTG
GCACAGAGAATTGCTTTTAGTGTAATTTGAATGTATTACCAGATTAGTCT
GGGTGCTGGAGCTCAGTCTGTACTGTACTGCAATCTGCTACAGATCAGCT
GTGTTGATGAATGGAGCCGCGCTGTCAAGCAGCTTACT
back to top