FC929864

Overview
NameFC929864
Unique NameFC929864
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length708
Libraries
Library NameType
PostHarvC1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9624 contig Ccv1_Contig9624:37..744. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC34001C06EF PostHarvC1 Citrus clementina cDNA clone C34001C06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929864 ID=FC929864|Name=FC929864|organism=Citrus clementina|type=EST|length=708bp
GAAGCAAAATCTCTCTAAATCTGTAAATCGGGTCGGTTTAAACATCTCTT
CTCTTTTCTTTGTTTCGCAATTCAAGATTTGAGTATGGAGGCAGCCGCAG
CAAGCGTGGCTCGATCTTCAATCGGCTTGCATAGTCACAGACCAGTTCTT
TTTTCTGTTTATTCTGGACCTGATTTTATTCGTTTTGGCACTAAATCGCT
TTTACCGATCAAGCATTACTCTTCAGTTTCAAACCCTAAGCCAAGGCATA
GGAGAAAGGGATTTGGAAGCAGGAGATGCATGGTCGTTAGAGCATCGTCT
TCTTCAGAATCATCTAGGTCAATGGATCCAATTGCTCCGCTTCAGCTGGA
GTCTCCAGTGGGACAGTTTTTGTCTCAGATTTTGATAAGCCACCCACACC
TTGTACCTGCAGCAGTTGAGCAGCAGCTTGAACAGCTTCAAACTGACCGT
GACGCTGAAAAACACGAGGAGGCTTCTGCTTCTGGCACTGAGCTTGTATT
GTATAGGAGAATTGCTGAGGTGAAGGCTAATGAAAGGAGAAAGGCATTAG
AAGAGATTTTGTATGCATTGGTTGTGCAGAAGTTCATGGATGCTAATGTT
TCCTTGATACCTTCTATTACCCCTTCTTCTTCAGACTCCTCTGGCCGGGT
GGACACGTGGCTAAGCCAAGATGAGAACCTTGAGCAGCTTCACTCATCTG
AAGCCTAT
back to top