FC929916

Overview
NameFC929916
Unique NameFC929916
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length707
Libraries
Library NameType
PostHarvC1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15064 contig Ccv1_Contig15064:1..708. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of FC929916 vs. ExPASy Swiss-Prot
Match: PSL1_HUMAN (Signal peptide peptidase-like 2B OS=Homo sapiens GN=SPPL2B PE=1 SV=2)

HSP 1 Score: 82.4185 bits (202), Expect = 2.580e-15
Identity = 63/226 (27.88%), Postives = 110/226 (48.67%), Query Frame = 1
Query:   22 MPKHKYAGDVIMVDRGNCKFTTKANIAEAAGASALLIINNQKELYKMVCDPDETDLD-IHIPAVMMPQDAGASLEKMLLNTSSVSVQLYSPRRPVVDVAEVFLWLMAVGTILCASYWSAWSARETAIEQEKLLKDAVDEIPDAKAVGVSGVVDINTASAVLFVLVASCFLVMLYKLMSNWFLELLVI----LFCIGGVEGLQTCL---VALLSGGSDVLENHSXKY 675
            +P   ++  + +V RGNC F  K  +A+ +GA  LLI++ ++ +       ++T  D I IP  ++       +      T  V   LY+P+ PV+D   V +++MAVGT+    YW+   +R+    +++ +K   D+ P+ +       VD+      +FV++    LV+LY     +F +LLV     +FC+    GL +CL   V  L  G   + N+S  Y
Sbjct:   81 LPARGFSNQIPLVARGNCTFYEKVRLAQGSGARGLLIVSRERLVPP---GGNKTQYDEIGIPVALLSYKDMLDIFTRFGRT--VRAALYAPKEPVLDYNMVIIFIMAVGTVAIGGYWA--GSRDV---KKRYMKHKRDDGPEKQE---DEAVDVTPVMTCVFVVMCCSMLVLLY-----YFYDLLVYVVIGIFCLASATGLYSCLAPCVRRLPFGKCRIPNNSLPY 288          
BLAST of FC929916 vs. ExPASy Swiss-Prot
Match: PSL1_RAT (Signal peptide peptidase-like 2B OS=Rattus norvegicus GN=Sppl2b PE=2 SV=1)

HSP 1 Score: 81.2629 bits (199), Expect = 5.747e-15
Identity = 51/200 (25.50%), Postives = 98/200 (49.00%), Query Frame = 1
Query:   22 MPKHKYAGDVIMVDRGNCKFTTKANIAEAAGASALLIINNQKELYKMVCDPDETDLDIHIPAVMMPQDAGASLEKMLLNTSSVSVQLYSPRRPVVDVAEVFLWLMAVGTILCASYWSAWSARETAIEQEKLLKDAVDEIPDAKAVGVSGVVDINTASAVLFVLVASCFLVMLYKLMSNWFLELLVILFCIGGVEGLQTCL 621
            +P   +   + +V RGNC F  K  +A+ +GA  LLI++ ++ +          ++ I + A++  +D      +       V V LY+P  PV+D   V +++MAVGT+    YW+       + + +K +K   D++P+ +       VD+      +FV V  CF+++L     +  + +++ +FC+    GL +CL
Sbjct:   75 VPVEDFTNQIALVARGNCTFYEKVRLAQGSGAHGLLIVSKERLVPPRGNKTQYEEISIPV-ALLSHRDLQDIFRRF---GHEVMVALYAPSEPVMDYNMVIIFIMAVGTVALGGYWAG------SHDVKKYMKHKRDDVPEKQE---DEAVDVTPVMICVFV-VMCCFMLVLLYYFYDRLVYVIIGIFCLASSTGLYSCL 260          
BLAST of FC929916 vs. ExPASy Swiss-Prot
Match: PSL1_MOUSE (Signal peptide peptidase-like 2B OS=Mus musculus GN=Sppl2b PE=2 SV=2)

HSP 1 Score: 78.9518 bits (193), Expect = 2.852e-14
Identity = 52/200 (26.00%), Postives = 97/200 (48.50%), Query Frame = 1
Query:   22 MPKHKYAGDVIMVDRGNCKFTTKANIAEAAGASALLIINNQKELYKMVCDPDETDLDIHIPAVMMPQDAGASLEKMLLNTSSVSVQLYSPRRPVVDVAEVFLWLMAVGTILCASYWSAWSARETAIEQEKLLKDAVDEIPDAKAVGVSGVVDINTASAVLFVLVASCFLVMLYKLMSNWFLELLVILFCIGGVEGLQTCL 621
            +P   +   + +V RGNC F  K  +A+ +GA  LLI++ +K +          ++ I + A++  +D      +       V V LY+P  PV+D   V +++MAVGT+    YW+       + + +K +K   D+ P+ +       VD+      +FV V  CF+++L     +  + +++ +FC+    GL +CL
Sbjct:   75 VPAEDFTNQIALVARGNCTFYEKVRLAQGSGAHGLLIVSKEKLVPPGGNKTQYEEISIPV-ALLSHRDLQDIFRRF---GREVMVALYAPSEPVMDYNMVIIFVMAVGTVAIGGYWAG------SHDVKKYMKHKRDDGPEKQE---DEAVDVTPVMICVFV-VMCCFMLVLLYYFYDRLVYVIIGIFCLASSTGLYSCL 260          
BLAST of FC929916 vs. ExPASy Swiss-Prot
Match: PSL2_MOUSE (Signal peptide peptidase-like 2A OS=Mus musculus GN=Sppl2a PE=2 SV=1)

HSP 1 Score: 73.9442 bits (180), Expect = 9.175e-13
Identity = 56/204 (27.45%), Postives = 94/204 (46.08%), Query Frame = 1
Query:   22 MPKHKYAGDVIMVDRGNCKFTTKANIAEAAGASALLIINNQKELYKMVCDPDETDLDIHIPAVMMPQDAGASLEKMLLNTSSVSVQLYSPRRPVVDVAEVFLWLMAVGTILCASYWSAWSARETAIEQEKLLKDAVDEIPDAKAVGVSGVVDINTASAVLFVLVASCFLVMLYKLMSNWFLELLVILFCIGGVEGLQTCLVALL 633
            +P        ++V  G C F  KA IA+  GA+ALLI NN   +          ++ + I AV+  +D     E +      ++V++YSP  P  D   V ++++AV T+    YWS        +E  K ++DA D     K       +  +  + V+FV++    +V+LY     W + +++ +FCI     L  CL AL+
Sbjct:   81 IPPDGIRNKAVVVHWGPCHFLEKARIAQEGGAAALLIANNSVLIPSSRNKSTFQNVTVLI-AVITQKDFKDMKETL---GDDITVKMYSPSWPNFDYTLVVIFVIAVFTVALGGYWSGL----IELENMKSVEDAEDRETRKKK---DDYLTFSPLTVVVFVVICCIMIVLLY-FFYRWLVYVMIAIFCIASSMSLYNCLSALI 272          
BLAST of FC929916 vs. ExPASy Swiss-Prot
Match: PSL2_HUMAN (Signal peptide peptidase-like 2A OS=Homo sapiens GN=SPPL2A PE=1 SV=2)

HSP 1 Score: 71.2478 bits (173), Expect = 5.947e-12
Identity = 51/196 (26.02%), Postives = 90/196 (45.92%), Query Frame = 1
Query:   52 IMVDRGNCKFTTKANIAEAAGASALLIINNQKELYKMVCDPDETDLDIHIPAVMMP--QDAGASLEKMLLNTSSVSVQLYSPRRPVVDVAEVFLWLMAVGTILCASYWSAWSARETAIEQEKLLKDAVDEIPDAKAVGVSGVVDINTASAVLFVLVASCFLVMLYKLMSNWFLELLVILFCIGGVEGLQTCLVALL 633
            ++V  G+C F  KA IA+  GA A+L++NN           +  D+ I I  +     +D   +L        +++V++YSP  P  D   V ++++AV T+    YWS        +E E L     ++    K       +  +  + V+FV++    +V+LY     W + +++ +FCI     L  CL AL+
Sbjct:   88 VVVPWGSCHFLEKARIAQKGGAEAMLVVNNSVLFPPSGNRSEFPDVKILIAFISYKDFRDMNQTL------GDNITVKMYSPSWPNFDYTMVVIFVIAVFTVALGGYWSG------LVELENLKAVTTEDREMRKK--KEEYLTFSPLTVVIFVVICCVMMVLLY-FFYKWLVYVMIAIFCIASAMSLYNCLAALI 268          
BLAST of FC929916 vs. ExPASy Swiss-Prot
Match: PSL1_CHICK (Signal peptide peptidase-like 2B OS=Gallus gallus GN=SPPL2B PE=2 SV=1)

HSP 1 Score: 71.2478 bits (173), Expect = 5.947e-12
Identity = 53/200 (26.50%), Postives = 94/200 (47.00%), Query Frame = 1
Query:   22 MPKHKYAGDVIMVDRGNCKFTTKANIAEAAGASALLIINNQKELYKMVCDPDETDLDIHIPAVMMPQDAGASLEKMLLNTSSVSVQLYSPRRPVVDVAEVFLWLMAVGTILCASYWSAWSARETAIEQEKLLKDAVDEIPDAKAVGVSGVVDINTASAVLFVLVASCFLVMLYKLMSNWFLELLVILFCIGGVEGLQTCL 621
            +P   +   + MV RGNC F  K  +A+  GA  LLI++ ++ +          ++DI  P  ++       + K      SV   +Y+P  PV+D   V +++MAVGT+    YW+   +R+    +E+ +K   D   D         VD+      +FV++    LV+LY    +  + +++ +FC+    GL +CL
Sbjct:   77 VPDGGFNNRIPMVMRGNCTFYEKVRLAQINGARGLLIVSRERLVPPGGNRSQYEEIDI--PVALLSYSDMLDIVKSF--GRSVKGAMYAPNEPVLDYNMVIIFVMAVGTVAIGGYWA--GSRDV---KERYMKHKRD---DGAEKHEDETVDVTPIMICVFVVMCCSMLVLLY-FFYDHLVYVIIGIFCLAASIGLYSCL 263          
BLAST of FC929916 vs. ExPASy Swiss-Prot
Match: IMP5_HUMAN (Signal peptide peptidase-like 2C OS=Homo sapiens GN=SPPL2C PE=1 SV=3)

HSP 1 Score: 67.3958 bits (163), Expect = 8.587e-11
Identity = 54/221 (24.43%), Postives = 93/221 (42.08%), Query Frame = 1
Query:   55 MVDRGNCKFTTKANIAEAAGASALLIINNQKELYKMVC--------DPDETDLDIHIPAVMMPQDAGASLEKMLLNTSSVSVQLYSPRRPVVDVAEVFLWLMAVGTILCASYWSAWSAR--------------------ETAIEQEKLLKDAVDEIPDAKAVGVSGVVDINTASAVLFVLVASCFLVMLYKLMSNWFLELLVILFCIGGVEGLQTCLVALL 633
            MV RGNC F TK  +A+  GA  LLI++   +     C        DP +   D+ IP  M+       +       + V V +Y+P  P++D   + ++++AVGT+    YW+  +                      + A   E   K+  ++IP      ++GV           V+  SC L++L     + F+ + + +F +G   GL +CL  L+
Sbjct:   95 MVMRGNCSFHTKGWLAQGQGAHGLLIVSRVSD---QQCSDTTLAPQDPRQPLADLTIPVAMLHYADMLDILSHTRGEAVVRVAMYAPPEPIIDYNMLVIFILAVGTVAAGGYWAGLTEANRLQRRRARRGGGSGGHHQLQEAAAAEGAQKEDNEDIPVDFTPAMTGV-----------VVTLSCSLMLLLYFFYDHFVYVTIGIFGLGAGIGLYSCLSPLV 301          
The following BLAST results are available for this feature:
BLAST of FC929916 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 7
Match NameE-valueIdentityDescription
PSL1_HUMAN2.580e-1527.88Signal peptide peptidase-like 2B OS=Homo sapiens G... [more]
PSL1_RAT5.747e-1525.50Signal peptide peptidase-like 2B OS=Rattus norvegi... [more]
PSL1_MOUSE2.852e-1426.00Signal peptide peptidase-like 2B OS=Mus musculus G... [more]
PSL2_MOUSE9.175e-1327.45Signal peptide peptidase-like 2A OS=Mus musculus G... [more]
PSL2_HUMAN5.947e-1226.02Signal peptide peptidase-like 2A OS=Homo sapiens G... [more]
PSL1_CHICK5.947e-1226.50Signal peptide peptidase-like 2B OS=Gallus gallus ... [more]
IMP5_HUMAN8.587e-1124.43Signal peptide peptidase-like 2C OS=Homo sapiens G... [more]
back to top
Properties
Property NameValue
Genbank descriptionC34001G11EF PostHarvC1 Citrus clementina cDNA clone C34001G11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929916 ID=FC929916|Name=FC929916|organism=Citrus clementina|type=EST|length=707bp
CATCCCCGGGATTGTTGCAGCATGCCAAAGCATAAGTATGCTGGAGATGT
CATCATGGTCGACCGAGGCAACTGCAAATTTACAACTAAAGCAAATATTG
CGGAGGCTGCTGGTGCTTCAGCCCTCCTCATCATAAATAACCAGAAAGAA
CTGTATAAGATGGTCTGTGATCCTGATGAAACTGATCTAGATATACACAT
ACCAGCTGTCATGATGCCCCAGGATGCTGGTGCCAGCTTGGAAAAGATGC
TTCTGAATACTTCATCAGTCTCTGTGCAGTTATATTCTCCACGACGACCG
GTAGTTGATGTAGCTGAAGTATTTTTATGGTTGATGGCAGTTGGTACCAT
CCTGTGTGCATCGTATTGGTCCGCATGGAGTGCCAGAGAAACAGCTATTG
AACAAGAGAAGTTATTGAAGGATGCTGTAGACGAAATTCCAGATGCCAAA
GCAGTAGGTGTTAGTGGTGTTGTGGACATTAACACAGCATCTGCTGTCCT
ATTCGTTTTAGTTGCTTCATGCTTCTTGGTCATGCTTTACAAACTTATGT
CAAACTGGTTCCTTGAGCTATTGGTCATTCTTTTCTGCATAGGTGGTGTA
GAGGGCTTGCAAACTTGCTTGGTTGCTTTATTATCAGGTGGTTCAGACGT
GCTGGAGAATCATTCATNCAAGTACCTTTCTTTGGAGCTGTCTCTCATCT
TACTTTG
back to top