FC929932

Overview
NameFC929932
Unique NameFC929932
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length714
Libraries
Library NameType
PostHarvC1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC929932_ssr72 microsatellite FC929932_ssr72:72..89. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig8915 contig Ccv1_Contig8915:267..980. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC34002A03EF PostHarvC1 Citrus clementina cDNA clone C34002A03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929932 ID=FC929932|Name=FC929932|organism=Citrus clementina|type=EST|length=714bp
GAATTTCCATGCGAAAACAAAAACACACGCAACACGCAACCAGCAATCAA
AAGAGAGAGCAACAAAAAGATGAAGAAGAAGAAGAAGAAGTCATTACCAT
CCCCAGAAGGACCAATCAGGAAACACTATATCCATCGTCCACCTGTCACC
ACTGTACCGAAACAACGGAGGTGGGCCCTTGTTGTTTGGCCCGCTGTAGT
CGCGTGATCGGATGACGGGGCGGTCATCGCAGTCAAACATAAGCTCCAAG
TCCGGTAATCTTCCGGGATACTTTCTAAGGAGTTGCAAGATGCCCCATAT
GGTGAAAACGTCTCTAGTTTGTATTGATTGTTTGTACTTGTGGATATATA
CTTTGTTGTTGACGAGTATTAGACGAAATGAGCCGTTTGATTGGCTCTTT
CTAACATGTCCCTTGTGATTCCTGTGACTTTCCAGGGGCTTAGATCTTCG
TGGATCCACCGAAAGTAATCTGGGCATGTGGATGTGGGTGGTATTGAGTA
ATCTGAAATTGATTCTTGTGTTTGAGATGTTTTGGGGTAATTTGTTGGGC
AAGTTTGGGTTTGGTTTTTGACACAATTGAGTGGGGTTGTGATTCTTTTT
GGTGGCCGGTTTTGTGGCTTTCGGGATACTATAATCACCGTTTTATTTCT
TGAGATATTGTGAACAGAAAAATTAGACTGCAAAATAATCGAAAAGGGGC
AATACTCGATCATA
back to top