FC929933

Overview
NameFC929933
Unique NameFC929933
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length700
Libraries
Library NameType
PostHarvC1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9425 contig Ccv1_Contig9425:734..1432. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC34002A04EF PostHarvC1 Citrus clementina cDNA clone C34002A04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929933 ID=FC929933|Name=FC929933|organism=Citrus clementina|type=EST|length=700bp
CCGGGGTTGTTACGATGGTGCTCGTTGTATAGTGAAAAATGGTTTTGAAG
GTGCCAGGAGGAGCCTCTATTTGAGATATACCGTAGAGTGGGTTGATTGG
GAGACTTCCATTGTGCCTGTTAAAATCTACATATTTGATGTCACTGACAA
TGAAACATGGTTTAGGGATTCCACTGGATGTCAGCATACAGCATCATTGC
CAGACTGAATATTCTGTTGATCCCTGTAAAGCCAATGATGTAGCTGATAA
TGGGTGTGTCCACACCAAAAGGACCAGTGTCACGATGCCAACCAGTGGTT
ACATCATCTATGGCGTTGCCCATCAGCACTCAGGGGGCATTGGTGCAGCT
CTATACAGAGAGGATGGACAACTTATGTGCTCTTCAATTCCAGCTTATGG
AAATGGGATGGAAGCTGGAAACGAGGCTGGATATATTGTAGGAATGTCGA
CCTGTTATCCTAAACCAGGCTCCCTCAGGATAACAGATGGGGAAACTCTG
ATTGTGGAATCTAGCTATAGTAGCTCCCGCGAACACACAGGAGTCATGGG
GCTTTTCTACATTTTGGTTGCAGACAGGGTGCCCGAGTCCAGTTCATTCT
TAGATGTTTTCAACAAGATGGACAGTGATATAAACCATTCTGCTTTTGTT
TGGGGAGCATTTGTTTTAGCCGGAGTTGCTGTCATTGCTGCCGCTGTGGG
back to top