FC929938

Overview
NameFC929938
Unique NameFC929938
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length542
Libraries
Library NameType
PostHarvC1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15068 contig Ccv1_Contig15068:1..542. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC34002A09EF PostHarvC1 Citrus clementina cDNA clone C34002A09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929938 ID=FC929938|Name=FC929938|organism=Citrus clementina|type=EST|length=542bp
GATACAAAGAAACCTGTCTCACCGTCCGTTTGTTCCAATTGATTAGACGG
TGAAGTTCCTACGGAGACCAGGTTAGGATTTTGAGAAAAGCAAAGATAAT
AAGAGCTGAAGTGGGTTTGTGTTGACGAAGGAGAATGGGTTCGTCTTCAG
TGATAACACCGGAAGATGTTTTGGAGTCTTTGATGAATGATGGCACCATT
GATTCTCTTAGACTGAAGATCATTAATCAGCTCAAAGCCAATGAAGAGCT
GAAGAATACAACCATTAAAATGGCAGAACAAAGTAAAGTGCTCAACACCC
CTGGGGCGGAGAAACAGACCAAAAGAGAGCTGTTTGATGCACTTCGGCAG
GAACTTGAAGCACCTGTGCTTGAGAAGGCCTCTAAATCAGTTTGGGAGTT
AATTCTGGACAGCAATGGGCTGGGGAAGGAGATAAGTGATACTGTTGGAA
GAGTGTATTCCCGATTAAGTGGCCGGGAACCTCCACTATTTCCTCCTCCA
TCTAGTGAGACCCAACCCGTTAAAGAGACTGAGAATGAGAAA
back to top