FC929939

Overview
NameFC929939
Unique NameFC929939
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length703
Libraries
Library NameType
PostHarvC1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9466 contig Ccv1_Contig9466:323..1026. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC34002A10EF PostHarvC1 Citrus clementina cDNA clone C34002A10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC929939 ID=FC929939|Name=FC929939|organism=Citrus clementina|type=EST|length=703bp
ACATATTTTAAGTTTTGAAAATGACCTAAACCAGCTATTCACCTTGTTTT
AACTGTATAAAAATTGTTTGCAGATGGAAAAGACTGTAGATATCAATGAG
AACAGTCGGTTCATGGAAGATCTGGAAATGCTTAGGATTGCACAAGATGA
ACAATTGCCAAGTTTTACGGCAGAGACAAGTCCAGATCATTTGCAAGATA
GGTTGGGTAGTTTTAAATTCCAGGGGAGTACTAACCCCTTAGAACAATTA
GGATTGTACATGAAGATGGATGACGATGATGAGGAAGAAGTTGAACCGCC
TCTAACTGCTAAAGAGCCAGTTAAAGATGTAGAGGAAGGAGAAATTGATT
GATCTGATTTTCCTTTTCTACCATTTTGAGGAACAAAATCAGAATGATGA
TTCTGAGTTTCGCGGGTGCACTCTGGATATTTTATTGTTTGCATCATGTT
TCAGCTATGTATGTGTGTTGCAATATCTTTTAACATATATGACAATGTGC
ACACAGCTGAAGAATGAAGAAGATTGACGTCTACTGGATTTGGGTCTGTG
ATCCTTGGGATGATATTGGTTCTTGGACTGGGATCTGCAGTGGAAATTGG
ATATACTTGTGCAGTTGATGCTGCGGGGTTTGGGTAGAAAGGTATTTGGA
TTTTTTCCCCCACTTTTTCTGCGATAGAATGAGGGTACGAGCTTTTGTTG
GTT
back to top