FC930179

Overview
NameFC930179
Unique NameFC930179
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length581
Libraries
Library NameType
PostHarvC1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC34004F04EF PostHarvC1 Citrus clementina cDNA clone C34004F04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC930179 ID=FC930179; Name=FC930179; organism=Citrus clementina; type=EST; length=581bp
GAAACCCACTCTCGTCGACATCATCATCATCAATTAACATATCTCCAACT
TCAGCTTCTTCTCCCACCTAACTTGTCATTTTTCTTCCTTTGCCTTTGCC
AGTCTTTTCTCTCTTCTATCAACTGCAAGCATGAGCTCCTACAATCAGAA
TCAGTCCTCAGTAGCATACCCCCCACCACCACCGTCTACAACGGCGGGTC
TGTACGTGGCGGCGCCACCACCGGCAGGTTATCCAACGAAAGACGGCGAT
CATGGTTACGCTCAAAATGCCCCCGTAGAAACCAAGTCCAGAGGTGATGG
CTTCTGGAAAGGATGTTGTGCTGGCTTGTGTTGCTGCTGTGCCTTGGACG
CCTGCTTCTGAACACACATACGCACGGTTGATCGTTTGATTTTGGGGATT
CTTTTTTATTTCCATTATTATATTACGTGTATAAATAATAATAATAAAAA
CAGTTCAGATTGTTCCTTAGTTTGATGATAGGAACGCCCCCGTGGCTTGA
GTTATTATTTTTGTATACCATTCTGTAGCCTTTTGATACACATACTCTTA
TTTTTGTATACCATTCTGTAGACTTTTGATG
back to top