FC930183

Overview
NameFC930183
Unique NameFC930183
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length721
Libraries
Library NameType
PostHarvC1cdna_library
Properties
Property NameValue
Genbank descriptionC34004F08EF PostHarvC1 Citrus clementina cDNA clone C34004F08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC930183 ID=FC930183; Name=FC930183; organism=Citrus clementina; type=EST; length=721bp
GACTCCACACTCACAAACTTAGCGCATTCAATTATTCATTCATTCTTTCT
TTCTTTGAATATTTTCCCGTGTTCCATCAATTTCTTTGCTTCGCAGATGG
CCAGTGTTGAGGTTCAATCGGCTGCGGCAACATTGGCAGAGAATGAGACA
CAAGAGGTGACCAACAAGAGTAGTAACGAGACAACCCCGGAAGAGGCGCC
AGTGGCAGCTGCCACCGAAGCTGAGACCGCAACTAAAGAACCAAAGGAAG
AAGCAACGGCCCCAGATGAGGCTCCAGCTGCTGAGGAACCAGCGGCTGAG
ACCCCAGTTGAAGTTGAAACCAAGAAAGTTGTAGAAGAAGCTAAGGTTGA
TGAGGCAGCTGATGCTGCAGTGGAAGAGAAAGCAGAACAAGTAGTGAAAC
CCGACCAAGAGCCTGTTACCGTTGAGGAAACCAAAGAAGAGGCCCCTAAG
GCTGAGGCTGAGGCAGCTCCGGTCCAGGAAGAGAAACCAGCTGAAGAGGA
GAAGCCAGCTAAAGCACCTGAAGAAGCAGCTTCCACAGGAGTTCCAGTCG
GCAAGACTGACTGAGGAATAGAGCCCTATCAAAAGTCGGCCAAGTTTTAT
TTACTTTTACATAATTTTTTGTTCTAAGTCAGTCTCGTTATTATTACTAT
TATTAAGTTTTTGATTAAGGGTTGTGATCTGAGGTTTGAATATGGAGCAT
AGGATTATGCCAGCGATTCGA
back to top