FC930184

Overview
NameFC930184
Unique NameFC930184
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length702
Libraries
Library NameType
PostHarvC1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC34004F09EF PostHarvC1 Citrus clementina cDNA clone C34004F09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC930184 ID=FC930184; Name=FC930184; organism=Citrus clementina; type=EST; length=702bp
GAAGGTCAATCAATCGTAGATCTAGAGAGAGAGAGAGAGAGAGAGAGGAA
GAGAGAGAGCTCTCTCTTCCGAGCTCTCGACTCCTCGGGAACTACGATTC
TTGTCAGTTCTACATTCAATCTTTCCTTCCACTTTCACCCACTGGTCACC
CACCAACTCTCTGGACTGGCTCTTTAAAAGCGAAACCCTAATAATAATAA
TCATAACTCGACGGTTGACAGTTACAGTCACAATGGAACCCCAGTTCTTT
ATTTTGTTCTTGTTAATGTTCTTCACAATCTACCTCGTCGCTTACTTCGT
CGTATTCCGAAGCTGGAGCCCCAAGATCCGACCCGAAGCGTCCAGCTGCC
TGATCTCCATCTTCCACGGGACCCCCGCGGTCGTCTTGGCCACCTACGCT
CTGCTCTCCAACAAATCCCGCGGCTTCTCCTCGCCCAACACCCCTCTCGA
GAACCTCGTCCTCGACTTTAGCATCGCCTACTTCGCTACCGATCTCCTCC
ACTACCTCGTCTTCTTCCCCGGCGACGTCCTCTTCATCGCCCACCACCTC
GCCACCCTCTTCGTCTTCCTCACCTGCAGGTGCCTCGTCTCCCACGGCGC
CTACGCCTTGCTCTCCCTCCTCATCCTCGCCGAAGTCACCAGCGCCTGCC
AGAACGCCTGGACCCTCGCCTGCGCCAGGAGCCACGACTCCGAGTTCGCC
GG
back to top