FC930809

Overview
NameFC930809
Unique NameFC930809
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length699
Libraries
Library NameType
PostHarvP1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC930809_ssr123 microsatellite FC930809_ssr123:123..134. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig6641 contig Ccv1_Contig6641:130..827. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC34109C06EF PostHarvP1 Citrus clementina cDNA clone C34109C06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC930809 ID=FC930809|Name=FC930809|organism=Citrus clementina|type=EST|length=699bp
GTAACAAAAATCATCACAAAAACACGACTAATTCTTTAAACAAATCGTCA
ATCTTCTTTTTTTTTCTTTTCTATTTCATGAAAAAATAATGGGAATTTCA
TGGAGCAACAGAAGAAGAAACAACCACCACCACCATCAGTTCTTGGCTCC
GCCGCCACCGCCTCCTCCTCCGCCACTTCCACCGTACCAAGAACCCACTT
TGTACGCCGCAACAAACCCACCTCCGCCACCTGCCCCACATCCTTATCAT
CCGCCCCACGCGCCGTACCCTGTACCCCCACCACAACCGCCGCCGCAGGC
ATCCGTAAACCCTTACTATTATCACTCACATGGGTACAATTCGTGCGGTT
ATCCGAATCCCATGATGGGAAGGTTCAGTTATCAGTTTCAGTACCAGCCT
CCTTATTATGCCAACCAGGCTCAATCTCAGGCTCACGGCTGGCCCGCTGC
TGCTAGGCAGTCTCAAGTGAGCCCCCCGCCGCCGTATGTTGATCATCAGA
GTGCTAACAAGGTGAGAGAACGATGTGAATGTGCATAAGCACACGTTGAA
GATTGAAGTTGATGAGGAAAACCCAGATCATGTGCTTGTGTCTTTTGTTT
TAGATGCCCTGTTCGATGGGAGCATCACTGTTTTCTACTTTGCCAAGGAA
GAGCTCAACTGCAAATGTGTTCCACTGCTTCCTGAAGCTTATATGCCGG
back to top