FC930812

Overview
NameFC930812
Unique NameFC930812
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length777
Libraries
Library NameType
PostHarvP1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig4338 contig Ccv1_Contig4338:1066..1842. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC34109C09EF PostHarvP1 Citrus clementina cDNA clone C34109C09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC930812 ID=FC930812|Name=FC930812|organism=Citrus clementina|type=EST|length=777bp
TCGCCGGGATGGAAAACCTGCCATGGATGTTGCGATTCAGAAGGCTCTGG
AAAAGAAGGCACAAGCTGGAAAGTGGGTTCAACCCCACGTGGAGACAATT
AAAGCTAAATGGATCCCAGCCGTGAAGGAGCAGTGGGTAGTTTTCACTAC
AAATGTTGAACCACATGTACAAACATTGAAGACAAAGACAATTGAAGCTT
GTGAGGCAACAAAGACTGCAGTAACTCCACACATTATTAGAGTTCAAGAA
GTTGTTGATCCTTACTTTCAGGAAGCCAAGAAGTTTAGCAAGCCATACAT
TGATCAGGTTGCAACTGTGGCAAAACCTCATGTTGACAATGTACGAGTGG
CACTGAAACCTTATACCAAGAAGGTTGTTCGGGCATATGGGAAATTTCTA
AAATCTGCAACCACGTACCATCATCAGGTCCAAGCGTCAGTGCAAGAAAT
GCTTAAAAAGCATGAGCTGACAAGTCCTCTTGCAACTAAAGAGTTAGAGT
GGTTTGCGGCATCTGCTTTATTGGTCCTACCTGTCATCATTTTGTTCAGA
ATTGGTTCAGCCATTTTCTGNCAAAAAGCAAGGAAGCCTGTTCGGCATTC
CCACCATCATTCTCGTCGTAAGGCCAAACGGGGACACCCAGACAAATAGA
GTGCTACGAGATTACTGTCAATTTGTTTCTGAAAGGGAGTTGACGCGTTA
GACTTGGGTTTCTTTGGGCTATAAAGTCCCATCATGTGAAGAGCTCTATA
TTTTGAAGCTCAGCATCATTTTTTTAA
back to top