FC930814

Overview
NameFC930814
Unique NameFC930814
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length708
Libraries
Library NameType
PostHarvP1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15218 contig Ccv1_Contig15218:1..708. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC34109C11EF PostHarvP1 Citrus clementina cDNA clone C34109C11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC930814 ID=FC930814|Name=FC930814|organism=Citrus clementina|type=EST|length=708bp
GGAAGAGATGGAAAAGGAGAGGGAAATGCTTCAACTTGCTGACGTGTTGC
GTGAGGAGAGAGTCCAGATGAAGCTCTCAGAGGCTAAGTACCATTTTGAG
GAGAAAAATGCAGCTGTGGAAAGGCTTAGAAATGAGCTTGAGGCTTACTT
GGGAACCAAAAAGGGTAAAGAAAATGGTGATATGTCCCCCAATTTTGAGA
GAATCAAGGAACTTGAAGCTTATTTGAAGAAAATCCAATTTGGTTCTTGT
GAAAATGGGGTGACGGGGGAGAATGAAGGGGAACTAGCCAATGGAGAAGA
GAACGATGGGGACAACGACTCAGCTGATAGTGATCTTCATTCCATTGAAT
TAAACATGGACAATGGTAGCCGCAGCTACAAGTGGAGTTATGCCCATGAT
GATCAAGAAGATCGGAAGAGGGTATCGGTTGATAAAGTATTTAAAGGGAG
GAAATCTATAGAGAAAATTCAATGGGGAAACATTTGCTTTGGAAGAGGAT
CTTCTAATATGGAGCAGAGCTTCCATGAACATTCAGGTGGGATCGACAGG
GAAAGATTAGCCGAGATCCTTTCACAGACTGAAACAGATCATGCTGACGA
AATTAAACAATATCGGTCCATAAAGAGTCTTAGAGACCACATACTATCCG
GTTCAAGACGATGTCACTCCAAGCTTTGCGAGTCCTACACGCCATGGGGA
CAATCCTT
back to top