FC930815

Overview
NameFC930815
Unique NameFC930815
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length603
Libraries
Library NameType
PostHarvP1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC930815_ssr443 microsatellite FC930815_ssr443:443..460. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig12303 contig Ccv1_Contig12303:529..1131. BLAST: Citrus Unigene V1 Contigs to Populus V2 proteins
Properties
Property NameValue
Genbank descriptionC34109C12EF PostHarvP1 Citrus clementina cDNA clone C34109C12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC930815 ID=FC930815|Name=FC930815|organism=Citrus clementina|type=EST|length=603bp
GAAGCAAAAATTCCTTAAAGAAGCTCGAAAACTTACTTTATTGCACATAC
CACATATCTCTGTGTTCTTGTCCGTTGATCTGTTGTTAAAAATTGTTGTT
TGTGAGTGATAATTGACAAGTATGGCTGAAGAGATCAAGAAGCAGCAGAA
GAGCCATGAGTACGAGCCGAGTGTTGGGACGGAAGGTGCAGTGGAGACCA
AGGATCGCGGGATGCTTGATTTCTTGGGGAAGAAAGAAGAGGAGAAACCT
CAACATCACGATCAGGAGGTGATCGCCACCGAGTTTGAGAAAGTTCATGT
CTCTGAGCCTCAGCCAAAGGTAGAGGAACACAGGAAGGAGGAGAAAGAGG
AAGAGAAGAAGCCCGGTTTCTTAGACAAACTTCACCGATCCACCAGCAGC
TCTAGCTCTTCAAGCGATGAGGAGGAGGGCGATGATGAGGAAAAGAAGAA
GAAGAAGAAGGAAAAGAAGGGACTGAAGGAGAAGCTCAAGGAGAAAATAT
CAGGTGAGAAAGAAGAGGGCACGACAGTCCCTGTCGAGAAACTTGATGAT
GTCCATGCTCCCCACCACCAGGAAGAAGCCCATCCTGAAGAAAAGAAAGG
ATT
back to top