FC930828

Overview
NameFC930828
Unique NameFC930828
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length716
Libraries
Library NameType
PostHarvP1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC930828_ssr214 microsatellite FC930828_ssr214:214..225. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig15139 contig Ccv1_Contig15139:463..1178. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC34109E02EF PostHarvP1 Citrus clementina cDNA clone C34109E02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC930828 ID=FC930828|Name=FC930828|organism=Citrus clementina|type=EST|length=716bp
GACATTTCTAGTTTTGACCCCTACTCATTTTCACCGAAGGCTCCTCGATG
TTCAAGTCGCTGGAAGGAGTTATTGGGCTTGAAAAAACTCTATCACAACA
GTACGGCTTGGAAAACCGAGACTACTAAAACGACGTCGTTCTCCTCTTCG
TCCTCGTCTACTCATGCAAAATCTTCATTAAAGCATTTTCTCCACAGAAA
CTCCAAATCTTCATCTTCTTCTTCTTCATGTTCCGTTTCCTCATCACTTG
ATGGTTCCTTGTACCTGCCTTTACTGAAAGACTCCGATTCCGAATCAGTC
TCTTTATCGTCGTCTCGGCTGTCGCTTTCCTCATCATCTTCCGGCCACGA
GCACGAGGATCTTCCGAGGCTCTCACTAGATTCCGACAACAAGCCGAGCC
TCAGCCCGAACCCGGATCCGAACCCGTTTGCGAACCCGCCGAGGATGAGA
ATGGTGAAGCCAAGGGAGTGCTCGCATAACCAGACGGTGGCAGGGAGGAC
AGGGCGGAGTCCGATTCGCAGAGAATCACAAGCGGCCCCGAGCAGAGGGG
TTTCAGTGGACAGTCCGAGGATGAACTCGTCGGGGAAGATAGTGTTTCAA
AGCTTGGAGAGAAGCTCGAGCAGCCCCAGTAGCTTCAATGGCGGGCCGAG
GTACAAGCACAGAGGAATGGAGAGATCTTATTCGGCTAATGGTCGAGTGA
CTCCGGTTCTTAACGT
back to top