FC930885

Overview
NameFC930885
Unique NameFC930885
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length649
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15229 contig Ccv1_Contig15229:1..649. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34110B01EF PostHarvP1 Citrus clementina cDNA clone C34110B01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC930885 ID=FC930885|Name=FC930885|organism=Citrus clementina|type=EST|length=649bp
CTGATAAACCAAACCTTGGGAACTTACTGAGATTGTTGATCCTCTTCAAT
GTCGAGTTGTCGCTATGCCAGAGAGCACTGATTCTACTAGCAAGGTTGCT
CGACTGCTTTACACAAATTCTGGTATTGGCATTCTTGCCCTTTGGTCAAA
TGGGGTTCAGAAGCTATGGAAATGGAACCGCACTGAACTGAATCCTAGTG
GAAAGGCAACTGCAGCTGTTGCCCCACAGCACTGGCAACCAAGCAATGGT
CTTCTTATGACCAATGATGTCCCAGAGAATGCCGAAGATGTGGTTCCGTG
CGTAGCACTCTCAAAAAATGACTCATATGTCATGTCTGCCGGTGGAGGAA
AAGTTTCGTTGTTTAATATGATGAACTTCAAGGTGATGACAACTTTTATG
TCACCTCCGCCAGCTTCAACTTTCCTAGCATTTCATCCTCAAGATAATAA
CATAATAGCAATTGGGATGGAAGATTCAACCATCCAAATTTACAATGTTA
GGGTGGATGAGGTTAAAACAAAACTAAAAGGTCACCAGAAGCACATTACT
GGTTTAGCATTTTCCACCAACCTTAACATCCTGGTTTCATCAGGTTCTGA
TGCTCAGCTAATCTTCTGGAACACTGATACGTGGGAAAAGAGGAAATCT
back to top