FC930889

Overview
NameFC930889
Unique NameFC930889
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length661
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15230 contig Ccv1_Contig15230:1..661. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of FC930889 vs. ExPASy Swiss-Prot
Match: Y3684_ARATH (Acyltransferase-like protein At3g26840, chloroplastic OS=Arabidopsis thaliana GN=At3g26840 PE=1 SV=1)

HSP 1 Score: 283.878 bits (725), Expect = 5.120e-76
Identity = 133/219 (60.73%), Postives = 169/219 (77.17%), Query Frame = 1
Query:    1 VGYHMLLGLELTPLVCQFMIERNILLRGIAHPLMFVRLRDGLLPDLATFDTHRIMGAVPVSGTNFYKLLSSKSHVLLYPGGMREALHRKGEEYKLLWPDHSEFVRMAARFGAKIIPFGAVGEDDIGQVVFDYDDLMKIPYFKAQIEALTGETIKLRTDANGEIQNQDIHLPGILPKLPGRFYYYFGKPIETEGRKQELRDREKCHELYIEVKSEVEKCI 657
            VGYHM+LG EL P+V Q M ERNI LRG+AHP++F  L+D L+ D   FD ++IMG VPVS  N YKLL  K+HVLLYPGG+REALHRKGEEYKL WP+ SEFVR+A++FGAKI+PFG VGEDDI ++V D +D   IP  K  +E  T +   +R     E+ NQ+ + PG++PK+PGRFYYYFGKPIET G+++EL+D+EK  ELY++VKSEVE+CI
Sbjct:  448 VGYHMILGFELAPMVIQLMTERNIHLRGLAHPMLFKNLQDSLV-DTKMFDKYKIMGGVPVSHFNIYKLLREKAHVLLYPGGVREALHRKGEEYKLFWPERSEFVRVASKFGAKIVPFGVVGEDDICEIVLDSNDQRNIPILKDLMEKATKDAGNIREGDESELGNQECYFPGLVPKIPGRFYYYFGKPIETAGKEKELKDKEKAQELYLQVKSEVEQCI 665          
BLAST of FC930889 vs. ExPASy Swiss-Prot
Match: Y1457_ARATH (Acyltransferase-like protein At1g54570, chloroplastic OS=Arabidopsis thaliana GN=At1g54570 PE=1 SV=1)

HSP 1 Score: 260.766 bits (665), Expect = 4.641e-69
Identity = 125/222 (56.31%), Postives = 167/222 (75.23%), Query Frame = 1
Query:    1 VGYHMLLGLELTPLVCQFMIERNILLRGIAHPLMFVRLRDGLLPDLATFDTHRIMGAVPVSGTNFYKLLSSKSHVLLYPGGMREALHRKGEEYKLLWPDHSEFVRMAARFGAKIIPFGAVGEDDIGQVVFDYDDLMKIPYFKAQIEALTGET--IKLRTDANGEIQNQDIHLPGILPKLPGRFYYYFGKPIETEGRKQELRDREKCHELYIEVKSEVEKCIA 660
            VGYHML+GLEL P+   F+ E+NIL RG+AHP+++         D    D  ++ GA PV+ TN +KLL SKSHVLL+PGG REALH +GE+YKL+WP+  EFVRMAARFGA I+PFG VGEDDI ++V DY+DLMKIP     I  +T +T   KLR ++ GE+ NQ ++LPG++PK+PGRFYY FGKPIET+GR + ++D+E+ +++Y+EVK+EVE  IA
Sbjct:  450 VGYHMLMGLELGPMSEAFIKEKNILFRGMAHPVLYSDNDPAKAFDYG--DWIKVFGAYPVTATNLFKLLDSKSHVLLFPGGAREALHNRGEQYKLIWPEQQEFVRMAARFGATIVPFGTVGEDDIAELVLDYNDLMKIPILNDYITEVTRDTKQFKLREESEGEVANQPLYLPGLIPKVPGRFYYLFGKPIETKGRPELVKDKEEANQVYLEVKAEVENSIA 669          
The following BLAST results are available for this feature:
BLAST of FC930889 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 2
Match NameE-valueIdentityDescription
Y3684_ARATH5.120e-7660.73Acyltransferase-like protein At3g26840, chloroplas... [more]
Y1457_ARATH4.641e-6956.31Acyltransferase-like protein At1g54570, chloroplas... [more]
back to top
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34110B05EF PostHarvP1 Citrus clementina cDNA clone C34110B05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC930889 ID=FC930889|Name=FC930889|organism=Citrus clementina|type=EST|length=661bp
GTTGGCTATCACATGTTACTAGGACTTGAATTGACTCCTCTGGTATGCCA
ATTTATGATCGAAAGAAATATTCTTCTACGAGGAATTGCACATCCACTGA
TGTTTGTCAGATTGAGAGACGGGTTGTTACCTGATTTAGCAACATTCGAC
ACACATAGAATAATGGGTGCAGTTCCTGTCTCAGGAACCAACTTCTACAA
GCTTTTATCTTCAAAGTCTCATGTCCTACTGTATCCTGGAGGCATGCGTG
AGGCTCTTCATAGAAAGGGTGAAGAGTACAAGTTGTTGTGGCCAGATCAC
TCTGAGTTTGTCAGGATGGCAGCTAGATTTGGGGCTAAAATCATACCTTT
TGGTGCTGTTGGAGAAGATGATATTGGTCAAGTAGTTTTTGATTATGATG
ACTTGATGAAGATTCCTTACTTTAAAGCTCAAATAGAGGCATTAACAGGC
GAGACTATCAAGTTGAGGACTGATGCAAACGGTGAGATACAGAACCAAGA
TATTCATCTACCAGGCATTCTACCCAAACTTCCAGGCCGCTTTTATTATT
ATTTTGGGAAACCAATTGAAACAGAAGGGAGGAAACAAGAATTAAGAGAC
AGGGAGAAATGTCATGAGTTGTATATAGAAGTAAAGTCTGAGGTTGAAAA
GTGCATTGCTT
back to top