FC930899

Overview
NameFC930899
Unique NameFC930899
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length693
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC930899_ssr299 microsatellite FC930899_ssr299:299..310. BLAST: Citrus ESTs to Prunus persica proteins V1
FC930899_ssr392 microsatellite FC930899_ssr392:392..403. BLAST: Citrus ESTs to Prunus persica proteins V1
FC930899_ssr414 microsatellite FC930899_ssr414:414..425. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig6973 contig Ccv1_Contig6973:81..773. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
PostHarvP1cdna_library
Properties
Property NameValue
Genbank descriptionC34110C03EF PostHarvP1 Citrus clementina cDNA clone C34110C03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC930899 ID=FC930899|Name=FC930899|organism=Citrus clementina|type=EST|length=693bp
ATCCAAAAGCCTCAGGTACTTGCTTACTCGTTCACGCATTTTTGAATCCA
TTGAATCTGTTGTCCTTTTTACCTAAAACGCTGCCGTTTAGGGTGTGCAC
GGCGGCGGATTTTCCCCCGGAAAGTTAAGGAGTATGCTTTTGGGAGTCGA
AAAGAAGAGAAAAGAAGATGATGATTTTGAATCCAGATCTCAACTTACTC
ATGTTCATGAATCATCATCAGGTGGTAATAATTTCGATAGTTGCAAAGAT
GTAGATGTTGTGAGTGTTCTTCCTGAATGCTCAACTTCATCATCATCTAC
AACAACAACAGCTGACTCATTAGCTGCGCAGATGCGAATGAATTCGGGAA
TCAGGTCTCAACAAGACCTCATCCTCCCTTTAGACTATGACAGTAGTAGT
AGTGGTGGTGGTNGGTGGTGGTGGTGCCCACCATGATAATCTCAATACCC
CTTTGTCTGTGTTTGAGTTTCATCAGAAGGCGGAGCAGCGGGCACCTCAG
GCTCAACGAGTGCCCCTTGCTCCATTTTCGAAACCTGCGCCTTTCCAATG
GGATGATGCCCAGAAGTGGATAGCGAGTCCTACTTCCAACAGGCTGGCTA
GGACCGGAAGCCACCCTCAAGGAGGTGGAGCTCGTAAAGTTGGTATTATG
GGCCGCCAGTTGTCCACCAGGTCGTTCATGAAGTTCCCCTGAT
back to top