FC931059

Overview
NameFC931059
Unique NameFC931059
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length694
Libraries
Library NameType
PostHarvP1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC931059_ssr458 microsatellite FC931059_ssr458:458..475. BLAST: Citrus ESTs to Prunus persica proteins V1
FC931059_ssr581 microsatellite FC931059_ssr581:581..592. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig15261 contig Ccv1_Contig15261:1..695. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC34101A01EF PostHarvP1 Citrus clementina cDNA clone C34101A01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931059 ID=FC931059|Name=FC931059|organism=Citrus clementina|type=EST|length=694bp
GACTCAAGTTTCTGCTCCTCCCGCCAACGCCGCTTAATCGATTGCTGCAG
AGAAAACCATTGAACAGGAATCCTACTCATAAGAATGGAGAACATAGAAT
CGGAAGAAATTGAAATCCTAAGAGGTGGTCCTATTTACACGGGTAATATG
GTGAGTCCTCTCACTAGGGTTCCTGATTTCGAGGATTCAGTTCTCCGGGA
GCTCAAGGAATTGGAGGATGAATTGTGTATGGACACGTCCCAATTCTACG
ACGACCATCTTTCGGTCGATGAGCTTAAGGTTTATACAGAAGACGAGTTA
ATGGATATGGCCTTGAAGGAAACTTTTACGAATCGATTGCGGGATGAAGG
GAATGCTGAAAATTCTTCACAGCCTTCAGAAGAGCGCTCCAGTGCAGGGA
GAAATTTAGAAAGATCAGGAAAACAAGAGAATAGAAAGAGCTCAACAAAG
AAGAAGCAGAAGAAGAAGAAGAAGAAGGCAAATCGTCTGACTGTAGATAA
TTTTATTGCCAAGGCAGAGCAGCTTTCCTCTATAAAACTGATAAAACAAA
AGCAAGATGAAGACAAAGCTGCAGCAAGACTTCATTCATTCAACTCTATT
TGCAAATTCAATGAATATGCCGTTCCATTCTCAGACAAAACTGAAAGGAT
GAAATCGCTTAGGTCTAATAATTCTGCAAAGTGGCTAAAGGCAT
back to top