FC931068

Overview
NameFC931068
Unique NameFC931068
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length564
Libraries
Library NameType
PostHarvP1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10191 contig Ccv1_Contig10191:14..576. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionC34101A11EF PostHarvP1 Citrus clementina cDNA clone C34101A11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC931068 ID=FC931068|Name=FC931068|organism=Citrus clementina|type=EST|length=564bp
ATCTATTTGTCTGCAAATCTTCTCATCGTTATATCACCAAAGGAAAACAA
AAAATGTCTGGCTGTGGTGGAAACTGTGGCTGTGGTTCTAGCTGCAAGTG
CGGCGGCGGCTGCGGCGGTAGCGCCATGTACCCTGACTTGAGATCCTTTG
AGAGCACCACCGTCGCCACCGAGACCCTCGTCCTCGGTGTTGCTCCTGTC
AAGATGCACTCTGAGGGGTCCGAGATGGGATTCGGAGCCGAGGGCGGCTG
CAAGTGTGGACCAAACTGCAAGTGCAACCCTTGTAACTGTTAATGAAGAT
TACGAGACGTGAACATGCCCCATAATAAAGCAGCGCTGTGAGGTCGTTTA
AATTGTAGTATCAATAAAAAAGAACTATTTGTCTTTTGTGGTTGGCTTTG
TTGGATGTCTTTTTATGAGCTTTTGTTTGTAAAATAAAAACCAGCCATGG
CTGCTTCTCCGAATCCTTAACTGGGTTTGTTGCAGATCCATGGCTAGTTA
ATTAATCATTAAGTGTATCTGTTACTGCTGCTTTTCTAATGGGAAGCTTC
CTCCCAAAAAAAAA
back to top